Incidental Mutation 'R1939:Ptprt'
ID 213787
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 039957-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R1939 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 161769560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 435 (N435S)
Ref Sequence ENSEMBL: ENSMUSP00000105068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109441
AA Change: N435S

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: N435S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109442
AA Change: N435S

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: N435S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109443
AA Change: N435S

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: N435S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109445
AA Change: N435S

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: N435S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,331,130 (GRCm39) W11R probably damaging Het
2700049A03Rik A G 12: 71,207,186 (GRCm39) probably null Het
4933409G03Rik T C 2: 68,419,328 (GRCm39) S26P possibly damaging Het
Ace2 A T X: 162,939,524 (GRCm39) M123L possibly damaging Het
Acot3 A G 12: 84,105,325 (GRCm39) N264S probably benign Het
Acvr1c A T 2: 58,173,517 (GRCm39) N248K probably damaging Het
Adam22 A T 5: 8,380,015 (GRCm39) F94L probably damaging Het
Adarb2 T C 13: 8,253,358 (GRCm39) probably null Het
Aldh1b1 A G 4: 45,802,755 (GRCm39) M98V possibly damaging Het
Arfgef2 T A 2: 166,715,548 (GRCm39) V1331D probably damaging Het
Atf2 G A 2: 73,676,563 (GRCm39) P184S probably damaging Het
Atp8b3 A T 10: 80,361,220 (GRCm39) C785* probably null Het
Birc6 T C 17: 74,977,332 (GRCm39) S4362P probably damaging Het
Brd10 A G 19: 29,731,077 (GRCm39) F712S possibly damaging Het
Chn1 A G 2: 73,455,245 (GRCm39) C39R probably damaging Het
Cngb1 C A 8: 96,026,320 (GRCm39) G154W probably damaging Het
Cntnap5b A G 1: 99,895,073 (GRCm39) H115R probably benign Het
Col23a1 A G 11: 51,442,816 (GRCm39) D159G unknown Het
Coro7 T C 16: 4,446,596 (GRCm39) E843G probably benign Het
Dnase2a G T 8: 85,637,524 (GRCm39) A309S possibly damaging Het
Dync2h1 A G 9: 7,139,159 (GRCm39) probably null Het
Engase T A 11: 118,370,012 (GRCm39) N97K probably damaging Het
Fam83b A T 9: 76,400,362 (GRCm39) M247K probably damaging Het
Fer T C 17: 64,280,123 (GRCm39) S65P probably damaging Het
Fgf10 A G 13: 118,925,688 (GRCm39) R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm904 T C 13: 50,798,772 (GRCm39) probably null Het
Gpat2 T A 2: 127,277,879 (GRCm39) *802K probably null Het
Hcfc2 G T 10: 82,538,284 (GRCm39) R107L probably damaging Het
Itga8 T G 2: 12,305,657 (GRCm39) D111A probably damaging Het
Jag1 C G 2: 136,925,393 (GRCm39) V1070L possibly damaging Het
Lama5 T C 2: 179,832,714 (GRCm39) N1646S probably benign Het
Lgals8 T G 13: 12,474,069 (GRCm39) I10L probably benign Het
Lrp1b A G 2: 40,587,601 (GRCm39) S116P unknown Het
Mcpt1 A T 14: 56,256,546 (GRCm39) K94I possibly damaging Het
Mpnd T C 17: 56,322,920 (GRCm39) F384S probably damaging Het
Mrgprb5 A T 7: 47,818,686 (GRCm39) N16K probably benign Het
Myo15b A G 11: 115,778,529 (GRCm39) T1139A probably benign Het
Nat8f5 A C 6: 85,794,801 (GRCm39) I53R possibly damaging Het
Nav1 A T 1: 135,393,636 (GRCm39) L1034Q probably damaging Het
Nudt6 T C 3: 37,459,379 (GRCm39) Y54C probably damaging Het
Or10j3b G T 1: 173,043,499 (GRCm39) A94S probably benign Het
Or5p58 A G 7: 107,694,348 (GRCm39) V143A probably benign Het
Or6c217 A C 10: 129,737,970 (GRCm39) M203R probably damaging Het
Or8b35 A G 9: 37,904,385 (GRCm39) N199S probably benign Het
Or8c15 T A 9: 38,120,725 (GRCm39) Y72* probably null Het
Osbpl8 A T 10: 111,125,672 (GRCm39) H784L probably benign Het
Osr1 T G 12: 9,629,687 (GRCm39) S187A probably damaging Het
Pcdhgc5 A G 18: 37,955,003 (GRCm39) Y759C probably damaging Het
Pkd1l2 G T 8: 117,772,921 (GRCm39) Y1035* probably null Het
Pla2g15 A G 8: 106,889,927 (GRCm39) T400A probably damaging Het
Pms1 A C 1: 53,236,135 (GRCm39) L715R probably damaging Het
Prkd1 T C 12: 50,441,777 (GRCm39) N254S probably benign Het
Prkdc T C 16: 15,653,777 (GRCm39) V3868A possibly damaging Het
Purb T C 11: 6,424,943 (GRCm39) E315G unknown Het
Rap1b A T 10: 117,654,491 (GRCm39) N116K probably damaging Het
Rmc1 T C 18: 12,313,562 (GRCm39) L15P probably damaging Het
Rp1l1 A G 14: 64,267,042 (GRCm39) N876S probably benign Het
Rps6ka4 T A 19: 6,816,834 (GRCm39) I114F probably damaging Het
Semp2l1 T C 1: 32,584,627 (GRCm39) I428V probably damaging Het
Sh3bp2 A G 5: 34,708,963 (GRCm39) N19D probably damaging Het
Slc16a4 A G 3: 107,208,317 (GRCm39) M276V probably benign Het
Slc17a1 A G 13: 24,059,864 (GRCm39) T172A probably benign Het
Slc4a7 C T 14: 14,748,581 (GRCm38) A320V probably damaging Het
Slco1a6 T A 6: 142,078,956 (GRCm39) Y113F probably damaging Het
Srsf6 C T 2: 162,776,403 (GRCm39) probably benign Het
St3gal6 A T 16: 58,293,924 (GRCm39) probably null Het
Tdp2 A G 13: 25,025,260 (GRCm39) D343G probably benign Het
Tecpr2 T A 12: 110,899,603 (GRCm39) L657Q probably damaging Het
Tet2 T C 3: 133,194,399 (GRCm39) T12A possibly damaging Het
Trappc6a T A 7: 19,248,426 (GRCm39) F28I probably damaging Het
Trim32 G A 4: 65,532,303 (GRCm39) V287I probably benign Het
Trpd52l3 T C 19: 29,981,289 (GRCm39) S15P probably damaging Het
Tsnaxip1 A G 8: 106,566,670 (GRCm39) I169V probably benign Het
Ttc34 G A 4: 154,950,139 (GRCm39) A1031T possibly damaging Het
Ttll11 T A 2: 35,830,765 (GRCm39) Q18L probably null Het
Ttll8 A T 15: 88,799,689 (GRCm39) I584N probably damaging Het
Ubiad1 A G 4: 148,528,468 (GRCm39) L147P probably damaging Het
Ucp3 T C 7: 100,129,871 (GRCm39) V171A probably benign Het
Vmn1r174 T A 7: 23,453,532 (GRCm39) I66N probably damaging Het
Vmn2r13 T C 5: 109,339,852 (GRCm39) D41G possibly damaging Het
Vmn2r4 T C 3: 64,305,976 (GRCm39) D393G probably benign Het
Wipf2 C T 11: 98,783,236 (GRCm39) R221* probably null Het
Zfp976 C A 7: 42,263,105 (GRCm39) C244F unknown Het
Zmym5 A G 14: 57,036,577 (GRCm39) V190A probably damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATTCCCATAAACTGGCC -3'
(R):5'- TGTGGAAGAGCAACAGTATCC -3'

Sequencing Primer
(F):5'- ATAAACTGGCCTCCCTCACTC -3'
(R):5'- TGGAAGAGCAACAGTATCCATCTGC -3'
Posted On 2014-07-14