Mutagenetix > Incidental Mutations

Incidental Mutation 'R0126:Tbx18'

21379

Institutional Source

Beutler Lab

Gene Symbol

Tbx18

Ensembl Gene

ENSMUSG00000032419

Gene Name

T-box18

Synonyms

2810404D13Rik, 2810012F10Rik

MMRRC Submission

038411-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0126 (G1)

Quality Score

154

Status

Validated (trace)

Chromosome

Chromosomal Location

87702800-87731260 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 87729653 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 108 (D108V)

Ref Sequence

ENSEMBL: ENSMUSP00000034991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034991]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034991
AA Change: D108V

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000034991
Gene: ENSMUSG00000032419
AA Change: D108V

Domain	Start	End	E-Value	Type
low complexity region	30	41	N/A	INTRINSIC
low complexity region	67	87	N/A	INTRINSIC
low complexity region	113	132	N/A	INTRINSIC
TBOX	144	341	8.7e-127	SMART
low complexity region	461	476	N/A	INTRINSIC
low complexity region	555	567	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186698

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192660

Meta Mutation Damage Score

0.0715

Coding Region Coverage

1x: 98.8%
3x: 97.6%
10x: 93.2%
20x: 81.8%

Validation Efficiency

98% (102/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This genes codes for a member of an evolutionarily conserved family of transcription factors that plays a crucial role in embryonic development. The family is characterized by the presence of the DNA-binding T-box domain and is divided into five sub-families based on sequence conservation in this domain. The encoded protein belongs to the vertebrate specific Tbx1 sub-family. The protein acts as a transcriptional repressor by antagonizing transcriptional activators in the T-box family. The protein forms homo- or heterodimers with other transcription factors of the T-box family or other transcription factors. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice fail to maintain anterior-posterior polarity of the lateral sclerotome and display neonatal lethality and abnormal vertebral, rib and spinal nerve morphology. Mice homozygous for another targeted allele exhibit neonatal lethality, abnormal skeleton and abnormal coronary vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	T	C	2: 25,443,730	L1730P	possibly damaging	Het
Adam9	T	C	8: 24,970,737	N577S	probably damaging	Het
Add1	T	C	5: 34,613,579	Y316H	probably benign	Het
Agpat3	T	C	10: 78,278,056	D266G	probably null	Het
Aldh3a2	C	A	11: 61,224,558	Q524H	probably benign	Het
Alox12b	A	C	11: 69,167,471	S550R	probably benign	Het
Ano4	T	A	10: 88,952,292	I753F	possibly damaging	Het
AW011738	T	A	4: 156,203,647		probably benign	Het
B4galt3	C	T	1: 171,276,165	T103M	probably damaging	Het
Cabs1	C	T	5: 87,980,195	T235I	probably damaging	Het
Casc4	T	C	2: 121,906,084		probably benign	Het
Casq2	A	G	3: 102,133,399	H272R	probably damaging	Het
Ccdc180	T	C	4: 45,912,866		probably null	Het
Cdh12	A	T	15: 21,583,945	M624L	probably benign	Het
Cdh5	A	C	8: 104,140,682		probably null	Het
Col7a1	A	G	9: 108,969,583		probably benign	Het
Cpne2	A	T	8: 94,554,933	I199F	probably damaging	Het
Crebbp	A	T	16: 4,084,063	F2399L	possibly damaging	Het
Defb36	T	C	2: 152,612,579	C53R	probably damaging	Het
Degs1	T	C	1: 182,279,692	M1V	probably null	Het
Disp2	T	A	2: 118,790,338	F517Y	probably damaging	Het
Dnah5	A	G	15: 28,246,319	D601G	probably benign	Het
Dnpep	G	A	1: 75,312,538	Q310*	probably null	Het
Dsg1a	A	G	18: 20,340,878	T1003A	probably benign	Het
Fbrsl1	C	G	5: 110,396,040		probably benign	Het
Foxh1	A	T	15: 76,669,254	L116H	probably damaging	Het
Gigyf2	G	A	1: 87,411,875		probably benign	Het
Gp1ba	A	T	11: 70,641,033		probably benign	Het
Gucy1b1	A	G	3: 82,037,911		probably benign	Het
Gucy2g	T	G	19: 55,241,166	D24A	probably benign	Het
Hirip3	A	G	7: 126,863,442	K190R	probably damaging	Het
Hmmr	T	C	11: 40,705,954	N717D	probably damaging	Het
Il12b	A	T	11: 44,410,218	Y187F	probably damaging	Het
Iqgap1	A	G	7: 80,738,322	I859T	probably benign	Het
Jmjd1c	T	C	10: 67,219,326	L175P	probably damaging	Het
Klc2	T	C	19: 5,112,746	M242V	possibly damaging	Het
Klf3	T	C	5: 64,822,103	M96T	probably benign	Het
Lrrc66	G	T	5: 73,607,088	H871N	probably benign	Het
Ltn1	A	T	16: 87,425,640	D168E	probably benign	Het
Mak	T	C	13: 41,032,596	D532G	probably damaging	Het
March6	A	G	15: 31,462,005	M859T	probably benign	Het
Mlxipl	C	A	5: 135,132,323	N365K	probably damaging	Het
Mplkip	T	C	13: 17,695,752	S90P	possibly damaging	Het
Myo5c	A	T	9: 75,269,525	H584L	probably benign	Het
Myt1l	A	G	12: 29,851,720	T228A	possibly damaging	Het
Nxpe3	A	T	16: 55,866,229	Y139N	possibly damaging	Het
Olfr1090	T	A	2: 86,754,637	I34L	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr568	A	G	7: 102,877,140	T7A	probably benign	Het
Pak6	C	T	2: 118,690,332	S268F	possibly damaging	Het
Parp10	G	A	15: 76,243,066	A57V	probably damaging	Het
Pik3r3	T	A	4: 116,256,268	D69E	probably damaging	Het
Polr2a	T	G	11: 69,747,425	K105T	probably damaging	Het
Prdm16	A	T	4: 154,328,838		probably benign	Het
Prepl	G	A	17: 85,083,242	T96I	probably benign	Het
Ret	C	T	6: 118,165,995		probably benign	Het
Rgl3	A	T	9: 21,975,812	D541E	probably benign	Het
Rpa1	A	C	11: 75,318,529	Y143D	probably benign	Het
Rps16	T	A	7: 28,351,083	L47Q	probably damaging	Het
Sbno2	A	T	10: 80,068,853		probably null	Het
Scube1	A	T	15: 83,621,063	N385K	probably damaging	Het
Shank2	A	G	7: 144,031,355	E31G	probably damaging	Het
Slc38a9	G	T	13: 112,729,257	C496F	possibly damaging	Het
Snap47	A	G	11: 59,437,987	V163A	probably damaging	Het
Sntg2	T	C	12: 30,201,261		probably benign	Het
Sp7	C	A	15: 102,358,460	V322F	probably damaging	Het
Spic	T	C	10: 88,676,062	K111E	probably damaging	Het
Sqor	T	C	2: 122,798,027		probably benign	Het
St6galnac1	T	A	11: 116,766,584	M385L	probably benign	Het
Synpo2	A	T	3: 123,079,862	S1211T	possibly damaging	Het
Sytl2	T	A	7: 90,396,589	V638E	probably damaging	Het
Taar1	T	A	10: 23,920,547	S48T	probably benign	Het
Tdh	C	T	14: 63,497,593		probably benign	Het
Tldc1	T	C	8: 119,762,350	D398G	possibly damaging	Het
Tlr9	T	A	9: 106,225,682	L724Q	probably benign	Het
Tmem270	T	A	5: 134,902,788	Y100F	probably benign	Het
Trim65	G	C	11: 116,124,604		probably benign	Het
Trrap	A	T	5: 144,805,750	K1393*	probably null	Het
Ttc13	A	G	8: 124,683,291	V523A	probably damaging	Het
Utrn	T	A	10: 12,711,475	D939V	probably benign	Het
Vmn1r46	G	T	6: 89,976,953	M261I	probably benign	Het
Vwa5a	A	G	9: 38,737,807		probably null	Het
Zfp108	A	T	7: 24,260,724	T247S	probably benign	Het
Zfp366	A	T	13: 99,228,621	I97F	probably benign	Het
Zfp986	C	T	4: 145,898,943	R58C	probably benign	Het

Other mutations in Tbx18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Tbx18	APN	9	87705623	missense	possibly damaging	0.90
IGL00832:Tbx18	APN	9	87705661	missense	probably damaging	1.00
IGL01287:Tbx18	APN	9	87724331	missense	probably damaging	0.98
IGL01406:Tbx18	APN	9	87713543	missense	probably damaging	0.99
IGL01587:Tbx18	APN	9	87724408	missense	probably damaging	0.99
IGL01898:Tbx18	APN	9	87707859	missense	possibly damaging	0.92
IGL02624:Tbx18	APN	9	87727406	missense	probably damaging	1.00
IGL03057:Tbx18	APN	9	87730829	missense	probably damaging	0.99
IGL03252:Tbx18	APN	9	87705580	missense	probably damaging	1.00
R0243:Tbx18	UTSW	9	87715516	splice site	probably benign
R0374:Tbx18	UTSW	9	87724355	missense	probably damaging	0.97
R0666:Tbx18	UTSW	9	87724409	missense	probably benign	0.13
R2141:Tbx18	UTSW	9	87715653	missense	probably damaging	0.99
R2183:Tbx18	UTSW	9	87705736	missense	probably damaging	0.98
R2233:Tbx18	UTSW	9	87724350	missense	probably damaging	1.00
R2234:Tbx18	UTSW	9	87724350	missense	probably damaging	1.00
R2235:Tbx18	UTSW	9	87724350	missense	probably damaging	1.00
R3835:Tbx18	UTSW	9	87729636	missense	probably benign
R4214:Tbx18	UTSW	9	87724465	missense	probably damaging	1.00
R4606:Tbx18	UTSW	9	87730769	missense	possibly damaging	0.84
R4834:Tbx18	UTSW	9	87727449	missense	possibly damaging	0.48
R5112:Tbx18	UTSW	9	87715687	missense	probably damaging	1.00
R5887:Tbx18	UTSW	9	87713513	missense	possibly damaging	0.58
R6628:Tbx18	UTSW	9	87715535	nonsense	probably null
R6659:Tbx18	UTSW	9	87707811	missense	probably damaging	1.00
R7001:Tbx18	UTSW	9	87727404	missense	probably damaging	1.00
R7057:Tbx18	UTSW	9	87705264	missense	possibly damaging	0.94
R7167:Tbx18	UTSW	9	87707830	missense	probably damaging	1.00
R7368:Tbx18	UTSW	9	87730697	missense	probably benign
R8147:Tbx18	UTSW	9	87724358	missense	probably damaging	0.97
R8993:Tbx18	UTSW	9	87730717	missense	probably benign	0.00
R9263:Tbx18	UTSW	9	87729468	missense	probably damaging	0.97
R9291:Tbx18	UTSW	9	87729482	missense	probably damaging	1.00
R9396:Tbx18	UTSW	9	87727379	missense	probably damaging	1.00
R9420:Tbx18	UTSW	9	87730622	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTAAATGAAACTGGGCCGGGATG -3'
(R):5'- TAGGAACTCGGTGGGACCCTAAAG -3'

Sequencing Primer
(F):5'- GGAGACTCAAGCTTACCTGC -3'
(R):5'- GGCCTCAAGGCAACTCC -3'

Posted On

2013-04-11