Mutagenetix > Incidental Mutation

Incidental Mutation 'R1939:Vmn2r4'

213792

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r4

Ensembl Gene

ENSMUSG00000092049

Gene Name

vomeronasal 2, receptor 4

Synonyms

EG637053

MMRRC Submission

039957-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R1939 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64388621-64415296 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 64398555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 393 (D393G)

Ref Sequence

ENSEMBL: ENSMUSP00000127513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170280] [ENSMUST00000175724]

AlphaFold

K7N784

Predicted Effect

probably benign
Transcript: ENSMUST00000170280
AA Change: D393G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000127513
Gene: ENSMUSG00000092049
AA Change: D393G

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	1	416	2.7e-72	PFAM
Pfam:Peripla_BP_6	61	240	1.9e-9	PFAM
Pfam:NCD3G	458	511	1.1e-17	PFAM
Pfam:7tm_3	542	779	1.8e-75	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175724
AA Change: D482G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000135228
Gene: ENSMUSG00000092049
AA Change: D482G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	88	505	2.3e-75	PFAM
Pfam:NCD3G	547	600	4.7e-17	PFAM
Pfam:7tm_3	633	867	8.2e-47	PFAM

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	T	A	11: 83,440,304	W11R	probably damaging	Het
2700049A03Rik	A	G	12: 71,160,412		probably null	Het
3110002H16Rik	T	C	18: 12,180,505	L15P	probably damaging	Het
4933409G03Rik	T	C	2: 68,588,984	S26P	possibly damaging	Het
9930021J03Rik	A	G	19: 29,753,677	F712S	possibly damaging	Het
Ace2	A	T	X: 164,156,528	M123L	possibly damaging	Het
Acot3	A	G	12: 84,058,551	N264S	probably benign	Het
Acvr1c	A	T	2: 58,283,505	N248K	probably damaging	Het
Adam22	A	T	5: 8,330,015	F94L	probably damaging	Het
Adarb2	T	C	13: 8,203,322		probably null	Het
Aldh1b1	A	G	4: 45,802,755	M98V	possibly damaging	Het
Arfgef2	T	A	2: 166,873,628	V1331D	probably damaging	Het
Atf2	G	A	2: 73,846,219	P184S	probably damaging	Het
Atp8b3	A	T	10: 80,525,386	C785*	probably null	Het
Birc6	T	C	17: 74,670,337	S4362P	probably damaging	Het
Chn1	A	G	2: 73,624,901	C39R	probably damaging	Het
Cngb1	C	A	8: 95,299,692	G154W	probably damaging	Het
Cntnap5b	A	G	1: 99,967,348	H115R	probably benign	Het
Col23a1	A	G	11: 51,551,989	D159G	unknown	Het
Coro7	T	C	16: 4,628,732	E843G	probably benign	Het
Dnase2a	G	T	8: 84,910,895	A309S	possibly damaging	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Engase	T	A	11: 118,479,186	N97K	probably damaging	Het
Fam83b	A	T	9: 76,493,080	M247K	probably damaging	Het
Fer	T	C	17: 63,973,128	S65P	probably damaging	Het
Fgf10	A	G	13: 118,789,152	R156G	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm5415	T	C	1: 32,545,546	I428V	probably damaging	Het
Gm904	T	C	13: 50,644,736		probably null	Het
Gpat2	T	A	2: 127,435,959	*802K	probably null	Het
Hcfc2	G	T	10: 82,702,450	R107L	probably damaging	Het
Itga8	T	G	2: 12,300,846	D111A	probably damaging	Het
Jag1	C	G	2: 137,083,473	V1070L	possibly damaging	Het
Lama5	T	C	2: 180,190,921	N1646S	probably benign	Het
Lgals8	T	G	13: 12,459,188	I10L	probably benign	Het
Lrp1b	A	G	2: 40,697,589	S116P	unknown	Het
Mcpt1	A	T	14: 56,019,089	K94I	possibly damaging	Het
Mpnd	T	C	17: 56,015,920	F384S	probably damaging	Het
Mrgprb5	A	T	7: 48,168,938	N16K	probably benign	Het
Myo15b	A	G	11: 115,887,703	T1139A	probably benign	Het
Nat8f5	A	C	6: 85,817,819	I53R	possibly damaging	Het
Nav1	A	T	1: 135,465,898	L1034Q	probably damaging	Het
Nudt6	T	C	3: 37,405,230	Y54C	probably damaging	Het
Olfr1404	G	T	1: 173,215,932	A94S	probably benign	Het
Olfr482	A	G	7: 108,095,141	V143A	probably benign	Het
Olfr815	A	C	10: 129,902,101	M203R	probably damaging	Het
Olfr881	A	G	9: 37,993,089	N199S	probably benign	Het
Olfr893	T	A	9: 38,209,429	Y72*	probably null	Het
Osbpl8	A	T	10: 111,289,811	H784L	probably benign	Het
Osr1	T	G	12: 9,579,687	S187A	probably damaging	Het
Pcdhgc5	A	G	18: 37,821,950	Y759C	probably damaging	Het
Pkd1l2	G	T	8: 117,046,182	Y1035*	probably null	Het
Pla2g15	A	G	8: 106,163,295	T400A	probably damaging	Het
Pms1	A	C	1: 53,196,976	L715R	probably damaging	Het
Prkd1	T	C	12: 50,394,994	N254S	probably benign	Het
Prkdc	T	C	16: 15,835,913	V3868A	possibly damaging	Het
Ptprt	T	C	2: 161,927,640	N435S	probably benign	Het
Purb	T	C	11: 6,474,943	E315G	unknown	Het
Rap1b	A	T	10: 117,818,586	N116K	probably damaging	Het
Rp1l1	A	G	14: 64,029,593	N876S	probably benign	Het
Rps6ka4	T	A	19: 6,839,466	I114F	probably damaging	Het
Sh3bp2	A	G	5: 34,551,619	N19D	probably damaging	Het
Slc16a4	A	G	3: 107,301,001	M276V	probably benign	Het
Slc17a1	A	G	13: 23,875,881	T172A	probably benign	Het
Slc4a7	C	T	14: 14,748,581	A320V	probably damaging	Het
Slco1a6	T	A	6: 142,133,230	Y113F	probably damaging	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
St3gal6	A	T	16: 58,473,561		probably null	Het
Tdp2	A	G	13: 24,841,277	D343G	probably benign	Het
Tecpr2	T	A	12: 110,933,169	L657Q	probably damaging	Het
Tet2	T	C	3: 133,488,638	T12A	possibly damaging	Het
Trappc6a	T	A	7: 19,514,501	F28I	probably damaging	Het
Trim32	G	A	4: 65,614,066	V287I	probably benign	Het
Trpd52l3	T	C	19: 30,003,889	S15P	probably damaging	Het
Tsnaxip1	A	G	8: 105,840,038	I169V	probably benign	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ttll11	T	A	2: 35,940,753	Q18L	probably null	Het
Ttll8	A	T	15: 88,915,486	I584N	probably damaging	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Ucp3	T	C	7: 100,480,664	V171A	probably benign	Het
Vmn1r174	T	A	7: 23,754,107	I66N	probably damaging	Het
Vmn2r13	T	C	5: 109,191,986	D41G	possibly damaging	Het
Wipf2	C	T	11: 98,892,410	R221*	probably null	Het
Zfp976	C	A	7: 42,613,681	C244F	unknown	Het
Zmym5	A	G	14: 56,799,120	V190A	probably damaging	Het

Other mutations in Vmn2r4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Vmn2r4	APN	3	64409779	splice site	probably null
IGL01448:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01452:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01454:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01456:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01463:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01467:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01468:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01470:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01476:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01481:Vmn2r4	APN	3	64406395	missense	probably damaging	0.99
IGL01534:Vmn2r4	APN	3	64406423	missense	probably damaging	1.00
IGL01636:Vmn2r4	APN	3	64406236	missense	probably benign	0.21
IGL01879:Vmn2r4	APN	3	64391010	missense	probably damaging	1.00
IGL02147:Vmn2r4	APN	3	64398361	splice site	probably benign
IGL02276:Vmn2r4	APN	3	64406456	missense	possibly damaging	0.95
IGL02432:Vmn2r4	APN	3	64406400	missense	probably benign	0.38
IGL02533:Vmn2r4	APN	3	64398419	nonsense	probably null
IGL02655:Vmn2r4	APN	3	64398465	missense	probably damaging	0.97
IGL02666:Vmn2r4	APN	3	64389012	missense	probably benign	0.10
IGL02902:Vmn2r4	APN	3	64406916	missense	probably benign	0.22
IGL03189:Vmn2r4	APN	3	64389168	missense	possibly damaging	0.89
IGL03250:Vmn2r4	APN	3	64406642	missense	probably damaging	1.00
IGL03271:Vmn2r4	APN	3	64398429	missense	probably benign	0.01
R0310:Vmn2r4	UTSW	3	64389434	nonsense	probably null
R0504:Vmn2r4	UTSW	3	64389363	missense	probably damaging	1.00
R1546:Vmn2r4	UTSW	3	64406888	missense	probably damaging	1.00
R1562:Vmn2r4	UTSW	3	64389444	missense	probably damaging	0.98
R1863:Vmn2r4	UTSW	3	64406989	missense	probably benign	0.33
R1873:Vmn2r4	UTSW	3	64391058	missense	possibly damaging	0.93
R2103:Vmn2r4	UTSW	3	64415283	missense	possibly damaging	0.48
R3083:Vmn2r4	UTSW	3	64389367	missense	probably damaging	1.00
R3687:Vmn2r4	UTSW	3	64389475	missense	possibly damaging	0.93
R3707:Vmn2r4	UTSW	3	64389474	missense	probably damaging	0.99
R3963:Vmn2r4	UTSW	3	64415151	missense	probably damaging	0.99
R4428:Vmn2r4	UTSW	3	64415169	missense	probably damaging	1.00
R4710:Vmn2r4	UTSW	3	64409780	critical splice donor site	probably null
R4737:Vmn2r4	UTSW	3	64409963	missense	probably damaging	1.00
R4767:Vmn2r4	UTSW	3	64390976	missense	probably damaging	0.99
R4776:Vmn2r4	UTSW	3	64388661	missense	probably damaging	0.96
R4834:Vmn2r4	UTSW	3	64410063	missense	probably benign	0.40
R4893:Vmn2r4	UTSW	3	64406255	missense	probably damaging	0.96
R4908:Vmn2r4	UTSW	3	64389055	missense	possibly damaging	0.59
R5049:Vmn2r4	UTSW	3	64398598	splice site	probably null
R5092:Vmn2r4	UTSW	3	64390952	missense	probably benign	0.01
R5234:Vmn2r4	UTSW	3	64398457	missense	possibly damaging	0.88
R5240:Vmn2r4	UTSW	3	64406937	missense	possibly damaging	0.53
R5704:Vmn2r4	UTSW	3	64409949	missense	probably benign	0.03
R5897:Vmn2r4	UTSW	3	64415266	nonsense	probably null
R5907:Vmn2r4	UTSW	3	64391066	missense	probably damaging	0.99
R5924:Vmn2r4	UTSW	3	64389264	missense	probably damaging	1.00
R6145:Vmn2r4	UTSW	3	64406943	missense	probably benign	0.00
R6191:Vmn2r4	UTSW	3	64415281	missense	probably benign	0.34
R6192:Vmn2r4	UTSW	3	64415278	missense	probably benign	0.00
R6207:Vmn2r4	UTSW	3	64406505	missense	probably damaging	1.00
R6457:Vmn2r4	UTSW	3	64409957	missense	probably damaging	1.00
R6533:Vmn2r4	UTSW	3	64415098	missense	probably benign
R6545:Vmn2r4	UTSW	3	64406356	missense	possibly damaging	0.50
R6594:Vmn2r4	UTSW	3	64389310	missense	probably damaging	1.00
R7049:Vmn2r4	UTSW	3	64389129	missense	probably benign	0.14
R7150:Vmn2r4	UTSW	3	64398477	missense	probably benign	0.01
R7187:Vmn2r4	UTSW	3	64415260	missense	probably benign	0.00
R7363:Vmn2r4	UTSW	3	64407011	missense	probably damaging	1.00
R7477:Vmn2r4	UTSW	3	64398429	missense	probably benign	0.01
R7675:Vmn2r4	UTSW	3	64415236	missense	probably benign	0.01
R7858:Vmn2r4	UTSW	3	64409805	missense	probably benign	0.00
R7888:Vmn2r4	UTSW	3	64406522	missense	probably damaging	0.99
R8678:Vmn2r4	UTSW	3	64406970	missense	probably benign
R8743:Vmn2r4	UTSW	3	64409826	missense	possibly damaging	0.95
R8841:Vmn2r4	UTSW	3	64406637	missense	probably damaging	0.97
R9671:Vmn2r4	UTSW	3	64409850	missense	probably benign	0.00
R9778:Vmn2r4	UTSW	3	64415076	missense	probably benign	0.15
X0019:Vmn2r4	UTSW	3	64406636	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTATGTCAGGTCAACCAACC -3'
(R):5'- CATACAACTGTAGTATACGTCAGTG -3'

Sequencing Primer
(F):5'- ACCAACCCTTGAAGATTCAGTGTTC -3'
(R):5'- CACCTGTGGCTAGAGGATATC -3'

Posted On

2014-07-14