Incidental Mutation 'R1939:Trim32'
ID213797
Institutional Source Beutler Lab
Gene Symbol Trim32
Ensembl Gene ENSMUSG00000051675
Gene Nametripartite motif-containing 32
Synonyms1810045E12Rik, Zfp117, BBS11, 3f3
MMRRC Submission 039957-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R1939 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location65604986-65616238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65614066 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 287 (V287I)
Ref Sequence ENSEMBL: ENSMUSP00000102989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050850] [ENSMUST00000068214] [ENSMUST00000084496] [ENSMUST00000107366] [ENSMUST00000155978] [ENSMUST00000156922]
Predicted Effect probably benign
Transcript: ENSMUST00000050850
AA Change: V287I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062277
Gene: ENSMUSG00000051675
AA Change: V287I

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
low complexity region 253 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Pfam:NHL 471 498 6.9e-7 PFAM
Pfam:NHL 618 645 4.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068214
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084496
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107366
AA Change: V287I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102989
Gene: ENSMUSG00000051675
AA Change: V287I

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
low complexity region 253 268 N/A INTRINSIC
low complexity region 307 321 N/A INTRINSIC
Pfam:NHL 373 400 3.6e-7 PFAM
Pfam:NHL 471 498 2.7e-7 PFAM
Pfam:NHL 618 645 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155978
SMART Domains Protein: ENSMUSP00000119579
Gene: ENSMUSG00000051675

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
Blast:BBOX 96 136 3e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000156922
SMART Domains Protein: ENSMUSP00000121949
Gene: ENSMUSG00000051675

DomainStartEndE-ValueType
RING 21 65 8.61e-9 SMART
BBOX 96 139 3.44e-8 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. The protein has also been localized to the nucleus, where it interacts with the activation domain of the HIV-1 Tat protein. The Tat protein activates transcription of HIV-1 genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit mild myopathy with sarcotubular myopathy, decreased fertility, and decreased axon diameter. Mice homozygous for a knock-out allele exhibit impaired adult muscle regeneration and myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,304 W11R probably damaging Het
2700049A03Rik A G 12: 71,160,412 probably null Het
3110002H16Rik T C 18: 12,180,505 L15P probably damaging Het
4933409G03Rik T C 2: 68,588,984 S26P possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acot3 A G 12: 84,058,551 N264S probably benign Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam22 A T 5: 8,330,015 F94L probably damaging Het
Adarb2 T C 13: 8,203,322 probably null Het
Aldh1b1 A G 4: 45,802,755 M98V possibly damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atp8b3 A T 10: 80,525,386 C785* probably null Het
Birc6 T C 17: 74,670,337 S4362P probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cntnap5b A G 1: 99,967,348 H115R probably benign Het
Col23a1 A G 11: 51,551,989 D159G unknown Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Dnase2a G T 8: 84,910,895 A309S possibly damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Engase T A 11: 118,479,186 N97K probably damaging Het
Fam83b A T 9: 76,493,080 M247K probably damaging Het
Fer T C 17: 63,973,128 S65P probably damaging Het
Fgf10 A G 13: 118,789,152 R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5415 T C 1: 32,545,546 I428V probably damaging Het
Gm904 T C 13: 50,644,736 probably null Het
Gpat2 T A 2: 127,435,959 *802K probably null Het
Hcfc2 G T 10: 82,702,450 R107L probably damaging Het
Itga8 T G 2: 12,300,846 D111A probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lgals8 T G 13: 12,459,188 I10L probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Mcpt1 A T 14: 56,019,089 K94I possibly damaging Het
Mpnd T C 17: 56,015,920 F384S probably damaging Het
Mrgprb5 A T 7: 48,168,938 N16K probably benign Het
Myo15b A G 11: 115,887,703 T1139A probably benign Het
Nat8f5 A C 6: 85,817,819 I53R possibly damaging Het
Nav1 A T 1: 135,465,898 L1034Q probably damaging Het
Nudt6 T C 3: 37,405,230 Y54C probably damaging Het
Olfr1404 G T 1: 173,215,932 A94S probably benign Het
Olfr482 A G 7: 108,095,141 V143A probably benign Het
Olfr815 A C 10: 129,902,101 M203R probably damaging Het
Olfr881 A G 9: 37,993,089 N199S probably benign Het
Olfr893 T A 9: 38,209,429 Y72* probably null Het
Osbpl8 A T 10: 111,289,811 H784L probably benign Het
Osr1 T G 12: 9,579,687 S187A probably damaging Het
Pcdhgc5 A G 18: 37,821,950 Y759C probably damaging Het
Pkd1l2 G T 8: 117,046,182 Y1035* probably null Het
Pla2g15 A G 8: 106,163,295 T400A probably damaging Het
Pms1 A C 1: 53,196,976 L715R probably damaging Het
Prkd1 T C 12: 50,394,994 N254S probably benign Het
Prkdc T C 16: 15,835,913 V3868A possibly damaging Het
Ptprt T C 2: 161,927,640 N435S probably benign Het
Purb T C 11: 6,474,943 E315G unknown Het
Rap1b A T 10: 117,818,586 N116K probably damaging Het
Rp1l1 A G 14: 64,029,593 N876S probably benign Het
Rps6ka4 T A 19: 6,839,466 I114F probably damaging Het
Sh3bp2 A G 5: 34,551,619 N19D probably damaging Het
Slc16a4 A G 3: 107,301,001 M276V probably benign Het
Slc17a1 A G 13: 23,875,881 T172A probably benign Het
Slc4a7 C T 14: 14,748,581 A320V probably damaging Het
Slco1a6 T A 6: 142,133,230 Y113F probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
St3gal6 A T 16: 58,473,561 probably null Het
Tdp2 A G 13: 24,841,277 D343G probably benign Het
Tecpr2 T A 12: 110,933,169 L657Q probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Trappc6a T A 7: 19,514,501 F28I probably damaging Het
Trpd52l3 T C 19: 30,003,889 S15P probably damaging Het
Tsnaxip1 A G 8: 105,840,038 I169V probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttll11 T A 2: 35,940,753 Q18L probably null Het
Ttll8 A T 15: 88,915,486 I584N probably damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ucp3 T C 7: 100,480,664 V171A probably benign Het
Vmn1r174 T A 7: 23,754,107 I66N probably damaging Het
Vmn2r13 T C 5: 109,191,986 D41G possibly damaging Het
Vmn2r4 T C 3: 64,398,555 D393G probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp976 C A 7: 42,613,681 C244F unknown Het
Zmym5 A G 14: 56,799,120 V190A probably damaging Het
Other mutations in Trim32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02142:Trim32 APN 4 65614499 missense probably damaging 1.00
IGL02534:Trim32 APN 4 65614669 missense possibly damaging 0.72
R0302:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0356:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0358:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0497:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0544:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0547:Trim32 UTSW 4 65613254 missense probably damaging 1.00
R0611:Trim32 UTSW 4 65613656 missense possibly damaging 0.71
R1183:Trim32 UTSW 4 65614391 missense probably benign 0.00
R1523:Trim32 UTSW 4 65614004 missense probably benign 0.04
R1784:Trim32 UTSW 4 65614397 missense probably damaging 0.96
R2069:Trim32 UTSW 4 65614776 nonsense probably null
R2869:Trim32 UTSW 4 65614457 missense probably damaging 1.00
R2869:Trim32 UTSW 4 65614457 missense probably damaging 1.00
R3875:Trim32 UTSW 4 65613466 missense possibly damaging 0.93
R5464:Trim32 UTSW 4 65614388 missense probably damaging 1.00
R6246:Trim32 UTSW 4 65614564 missense probably damaging 1.00
R6610:Trim32 UTSW 4 65615071 missense probably damaging 1.00
R8125:Trim32 UTSW 4 65613962 missense probably benign 0.05
R8128:Trim32 UTSW 4 65613445 missense probably damaging 1.00
R8430:Trim32 UTSW 4 65614706 missense probably damaging 1.00
Z1177:Trim32 UTSW 4 65614825 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAACATTGCTGAGGTGCAGG -3'
(R):5'- CTTCTTGAGAAACAGACACTGCTG -3'

Sequencing Primer
(F):5'- GCCGTGTCTCGCTGTGAC -3'
(R):5'- ACAGACACTGCTGGATACCGG -3'
Posted On2014-07-14