Mutagenetix > Incidental Mutations

Incidental Mutation 'R0126:Tlr9'

21380

Institutional Source

Beutler Lab

Gene Symbol

Tlr9

Ensembl Gene

ENSMUSG00000045322

Gene Name

toll-like receptor 9

Synonyms

MMRRC Submission

038411-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R0126 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

106222598-106226883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106225682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 724 (L724Q)

Ref Sequence

ENSEMBL: ENSMUSP00000082207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062241]

AlphaFold

Q9EQU3

PDB Structure

Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000062241
AA Change: L724Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: L724Q

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.8%
3x: 97.6%
10x: 93.2%
20x: 81.8%

Validation Efficiency

98% (102/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	T	C	2: 25,443,730	L1730P	possibly damaging	Het
Adam9	T	C	8: 24,970,737	N577S	probably damaging	Het
Add1	T	C	5: 34,613,579	Y316H	probably benign	Het
Agpat3	T	C	10: 78,278,056	D266G	probably null	Het
Aldh3a2	C	A	11: 61,224,558	Q524H	probably benign	Het
Alox12b	A	C	11: 69,167,471	S550R	probably benign	Het
Ano4	T	A	10: 88,952,292	I753F	possibly damaging	Het
AW011738	T	A	4: 156,203,647		probably benign	Het
B4galt3	C	T	1: 171,276,165	T103M	probably damaging	Het
Cabs1	C	T	5: 87,980,195	T235I	probably damaging	Het
Casc4	T	C	2: 121,906,084		probably benign	Het
Casq2	A	G	3: 102,133,399	H272R	probably damaging	Het
Ccdc180	T	C	4: 45,912,866		probably null	Het
Cdh12	A	T	15: 21,583,945	M624L	probably benign	Het
Cdh5	A	C	8: 104,140,682		probably null	Het
Col7a1	A	G	9: 108,969,583		probably benign	Het
Cpne2	A	T	8: 94,554,933	I199F	probably damaging	Het
Crebbp	A	T	16: 4,084,063	F2399L	possibly damaging	Het
Defb36	T	C	2: 152,612,579	C53R	probably damaging	Het
Degs1	T	C	1: 182,279,692	M1V	probably null	Het
Disp2	T	A	2: 118,790,338	F517Y	probably damaging	Het
Dnah5	A	G	15: 28,246,319	D601G	probably benign	Het
Dnpep	G	A	1: 75,312,538	Q310*	probably null	Het
Dsg1a	A	G	18: 20,340,878	T1003A	probably benign	Het
Fbrsl1	C	G	5: 110,396,040		probably benign	Het
Foxh1	A	T	15: 76,669,254	L116H	probably damaging	Het
Gigyf2	G	A	1: 87,411,875		probably benign	Het
Gp1ba	A	T	11: 70,641,033		probably benign	Het
Gucy1b1	A	G	3: 82,037,911		probably benign	Het
Gucy2g	T	G	19: 55,241,166	D24A	probably benign	Het
Hirip3	A	G	7: 126,863,442	K190R	probably damaging	Het
Hmmr	T	C	11: 40,705,954	N717D	probably damaging	Het
Il12b	A	T	11: 44,410,218	Y187F	probably damaging	Het
Iqgap1	A	G	7: 80,738,322	I859T	probably benign	Het
Jmjd1c	T	C	10: 67,219,326	L175P	probably damaging	Het
Klc2	T	C	19: 5,112,746	M242V	possibly damaging	Het
Klf3	T	C	5: 64,822,103	M96T	probably benign	Het
Lrrc66	G	T	5: 73,607,088	H871N	probably benign	Het
Ltn1	A	T	16: 87,425,640	D168E	probably benign	Het
Mak	T	C	13: 41,032,596	D532G	probably damaging	Het
March6	A	G	15: 31,462,005	M859T	probably benign	Het
Mlxipl	C	A	5: 135,132,323	N365K	probably damaging	Het
Mplkip	T	C	13: 17,695,752	S90P	possibly damaging	Het
Myo5c	A	T	9: 75,269,525	H584L	probably benign	Het
Myt1l	A	G	12: 29,851,720	T228A	possibly damaging	Het
Nxpe3	A	T	16: 55,866,229	Y139N	possibly damaging	Het
Olfr1090	T	A	2: 86,754,637	I34L	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr568	A	G	7: 102,877,140	T7A	probably benign	Het
Pak6	C	T	2: 118,690,332	S268F	possibly damaging	Het
Parp10	G	A	15: 76,243,066	A57V	probably damaging	Het
Pik3r3	T	A	4: 116,256,268	D69E	probably damaging	Het
Polr2a	T	G	11: 69,747,425	K105T	probably damaging	Het
Prdm16	A	T	4: 154,328,838		probably benign	Het
Prepl	G	A	17: 85,083,242	T96I	probably benign	Het
Ret	C	T	6: 118,165,995		probably benign	Het
Rgl3	A	T	9: 21,975,812	D541E	probably benign	Het
Rpa1	A	C	11: 75,318,529	Y143D	probably benign	Het
Rps16	T	A	7: 28,351,083	L47Q	probably damaging	Het
Sbno2	A	T	10: 80,068,853		probably null	Het
Scube1	A	T	15: 83,621,063	N385K	probably damaging	Het
Shank2	A	G	7: 144,031,355	E31G	probably damaging	Het
Slc38a9	G	T	13: 112,729,257	C496F	possibly damaging	Het
Snap47	A	G	11: 59,437,987	V163A	probably damaging	Het
Sntg2	T	C	12: 30,201,261		probably benign	Het
Sp7	C	A	15: 102,358,460	V322F	probably damaging	Het
Spic	T	C	10: 88,676,062	K111E	probably damaging	Het
Sqor	T	C	2: 122,798,027		probably benign	Het
St6galnac1	T	A	11: 116,766,584	M385L	probably benign	Het
Synpo2	A	T	3: 123,079,862	S1211T	possibly damaging	Het
Sytl2	T	A	7: 90,396,589	V638E	probably damaging	Het
Taar1	T	A	10: 23,920,547	S48T	probably benign	Het
Tbx18	T	A	9: 87,729,653	D108V	possibly damaging	Het
Tdh	C	T	14: 63,497,593		probably benign	Het
Tldc1	T	C	8: 119,762,350	D398G	possibly damaging	Het
Tmem270	T	A	5: 134,902,788	Y100F	probably benign	Het
Trim65	G	C	11: 116,124,604		probably benign	Het
Trrap	A	T	5: 144,805,750	K1393*	probably null	Het
Ttc13	A	G	8: 124,683,291	V523A	probably damaging	Het
Utrn	T	A	10: 12,711,475	D939V	probably benign	Het
Vmn1r46	G	T	6: 89,976,953	M261I	probably benign	Het
Vwa5a	A	G	9: 38,737,807		probably null	Het
Zfp108	A	T	7: 24,260,724	T247S	probably benign	Het
Zfp366	A	T	13: 99,228,621	I97F	probably benign	Het
Zfp986	C	T	4: 145,898,943	R58C	probably benign	Het

Other mutations in Tlr9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Tlr9	APN	9	106225007	missense	probably damaging	1.00
IGL01764:Tlr9	APN	9	106225805	missense	probably damaging	1.00
IGL02077:Tlr9	APN	9	106225505	missense	possibly damaging	0.90
IGL02232:Tlr9	APN	9	106224937	missense	probably damaging	1.00
IGL02851:Tlr9	APN	9	106224730	nonsense	probably null
Asura	UTSW	9	106224647	missense	probably damaging	1.00
Cpg1	UTSW	9	106225007	missense	probably damaging	1.00
Cpg11	UTSW	9	106224586	missense	probably damaging	1.00
Cpg2	UTSW	9	106226465	missense	probably damaging	1.00
Cpg3	UTSW	9	106224152	missense	probably damaging	1.00
Cpg5	UTSW	9	106224689	missense	probably damaging	1.00
Cpg6	UTSW	9	106226593	missense	probably damaging	1.00
cpg7	UTSW	9	106225349	missense	probably benign	0.00
Meager	UTSW	9	106224139	missense	probably damaging	1.00
PIT4498001:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0165:Tlr9	UTSW	9	106226087	missense	probably benign	0.10
R0534:Tlr9	UTSW	9	106224887	missense	probably benign	0.01
R0585:Tlr9	UTSW	9	106225076	missense	probably benign	0.01
R1527:Tlr9	UTSW	9	106223750	missense	probably benign	0.09
R1712:Tlr9	UTSW	9	106224049	missense	probably damaging	1.00
R1817:Tlr9	UTSW	9	106224943	missense	probably benign
R1940:Tlr9	UTSW	9	106224647	missense	probably damaging	1.00
R2117:Tlr9	UTSW	9	106225337	missense	probably damaging	1.00
R2656:Tlr9	UTSW	9	106223941	missense	probably benign	0.05
R3700:Tlr9	UTSW	9	106224079	missense	probably damaging	1.00
R4600:Tlr9	UTSW	9	106224533	missense	probably damaging	1.00
R4608:Tlr9	UTSW	9	106224974	missense	probably damaging	0.99
R4612:Tlr9	UTSW	9	106223807	missense	probably damaging	1.00
R4959:Tlr9	UTSW	9	106224677	missense	probably benign
R5173:Tlr9	UTSW	9	106225952	missense	possibly damaging	0.49
R5472:Tlr9	UTSW	9	106224313	missense	probably damaging	1.00
R5572:Tlr9	UTSW	9	106225637	missense	possibly damaging	0.47
R5618:Tlr9	UTSW	9	106224739	missense	possibly damaging	0.47
R5820:Tlr9	UTSW	9	106222707	critical splice donor site	probably null
R6393:Tlr9	UTSW	9	106224937	missense	probably damaging	1.00
R6397:Tlr9	UTSW	9	106225106	missense	probably damaging	1.00
R6455:Tlr9	UTSW	9	106223999	missense	probably damaging	1.00
R7385:Tlr9	UTSW	9	106225264	missense	probably damaging	1.00
R7455:Tlr9	UTSW	9	106224530	missense	probably benign	0.00
R7561:Tlr9	UTSW	9	106225949	missense	probably benign	0.00
R8889:Tlr9	UTSW	9	106222635	start gained	probably benign
R8892:Tlr9	UTSW	9	106222635	start gained	probably benign
R8926:Tlr9	UTSW	9	106226014	missense	probably benign
R9221:Tlr9	UTSW	9	106224773	missense	probably damaging	1.00
R9228:Tlr9	UTSW	9	106225553	missense	possibly damaging	0.49
Z1176:Tlr9	UTSW	9	106223663	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGAGCCTCCGAGACAACTACCTATC -3'
(R):5'- AGTGAAAGGCCAAAGCAGTCCC -3'

Sequencing Primer
(F):5'- CTATCTTTCTTTAACTGGACCAGTC -3'
(R):5'- TCCTGCGCGAAGATGCTAC -3'

Posted On

2013-04-11