Incidental Mutation 'R1939:Adam22'
ID213800
Institutional Source Beutler Lab
Gene Symbol Adam22
Ensembl Gene ENSMUSG00000040537
Gene Namea disintegrin and metallopeptidase domain 22
Synonyms2900022I03Rik, MDC2
MMRRC Submission 039957-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1939 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8072352-8368160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8330015 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 94 (F94L)
Ref Sequence ENSEMBL: ENSMUSP00000111044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046838] [ENSMUST00000050166] [ENSMUST00000088744] [ENSMUST00000088761] [ENSMUST00000115385] [ENSMUST00000115386] [ENSMUST00000115388]
Predicted Effect probably damaging
Transcript: ENSMUST00000046838
AA Change: F94L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049120
Gene: ENSMUSG00000040537
AA Change: F94L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 9.3e-9 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050166
AA Change: F94L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055000
Gene: ENSMUSG00000040537
AA Change: F94L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 7.6e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.4e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088744
AA Change: F94L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086122
Gene: ENSMUSG00000040537
AA Change: F94L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 4.2e-29 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 2.9e-65 PFAM
Pfam:Reprolysin_3 261 378 9.2e-13 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 736 758 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088761
AA Change: F94L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086139
Gene: ENSMUSG00000040537
AA Change: F94L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8.1e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.2e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 789 808 N/A INTRINSIC
low complexity region 860 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115385
AA Change: F94L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111043
Gene: ENSMUSG00000040537
AA Change: F94L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 40 186 5.2e-28 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin 237 333 2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115386
AA Change: F94L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111044
Gene: ENSMUSG00000040537
AA Change: F94L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 3.4e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 5.1e-9 PFAM
Pfam:Reprolysin 237 436 5e-59 PFAM
Pfam:Reprolysin_3 261 379 1.6e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 850 870 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115388
AA Change: F94L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111046
Gene: ENSMUSG00000040537
AA Change: F94L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 44 186 8e-27 PFAM
low complexity region 214 230 N/A INTRINSIC
Pfam:Reprolysin_5 235 405 1.1e-8 PFAM
Pfam:Reprolysin 237 436 1.1e-58 PFAM
Pfam:Reprolysin_3 261 379 3.5e-12 PFAM
DISIN 451 527 3.38e-31 SMART
ACR 528 669 3.05e-58 SMART
EGF 676 710 1.28e1 SMART
transmembrane domain 735 757 N/A INTRINSIC
low complexity region 852 872 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198595
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit severe ataxia, hypomyelination and premature death. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit severe ataxia, die before weaning and have marked hypomyelination of the peripheral nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,304 W11R probably damaging Het
2700049A03Rik A G 12: 71,160,412 probably null Het
3110002H16Rik T C 18: 12,180,505 L15P probably damaging Het
4933409G03Rik T C 2: 68,588,984 S26P possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acot3 A G 12: 84,058,551 N264S probably benign Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adarb2 T C 13: 8,203,322 probably null Het
Aldh1b1 A G 4: 45,802,755 M98V possibly damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atp8b3 A T 10: 80,525,386 C785* probably null Het
Birc6 T C 17: 74,670,337 S4362P probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cntnap5b A G 1: 99,967,348 H115R probably benign Het
Col23a1 A G 11: 51,551,989 D159G unknown Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Dnase2a G T 8: 84,910,895 A309S possibly damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Engase T A 11: 118,479,186 N97K probably damaging Het
Fam83b A T 9: 76,493,080 M247K probably damaging Het
Fer T C 17: 63,973,128 S65P probably damaging Het
Fgf10 A G 13: 118,789,152 R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5415 T C 1: 32,545,546 I428V probably damaging Het
Gm904 T C 13: 50,644,736 probably null Het
Gpat2 T A 2: 127,435,959 *802K probably null Het
Hcfc2 G T 10: 82,702,450 R107L probably damaging Het
Itga8 T G 2: 12,300,846 D111A probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lgals8 T G 13: 12,459,188 I10L probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Mcpt1 A T 14: 56,019,089 K94I possibly damaging Het
Mpnd T C 17: 56,015,920 F384S probably damaging Het
Mrgprb5 A T 7: 48,168,938 N16K probably benign Het
Myo15b A G 11: 115,887,703 T1139A probably benign Het
Nat8f5 A C 6: 85,817,819 I53R possibly damaging Het
Nav1 A T 1: 135,465,898 L1034Q probably damaging Het
Nudt6 T C 3: 37,405,230 Y54C probably damaging Het
Olfr1404 G T 1: 173,215,932 A94S probably benign Het
Olfr482 A G 7: 108,095,141 V143A probably benign Het
Olfr815 A C 10: 129,902,101 M203R probably damaging Het
Olfr881 A G 9: 37,993,089 N199S probably benign Het
Olfr893 T A 9: 38,209,429 Y72* probably null Het
Osbpl8 A T 10: 111,289,811 H784L probably benign Het
Osr1 T G 12: 9,579,687 S187A probably damaging Het
Pcdhgc5 A G 18: 37,821,950 Y759C probably damaging Het
Pkd1l2 G T 8: 117,046,182 Y1035* probably null Het
Pla2g15 A G 8: 106,163,295 T400A probably damaging Het
Pms1 A C 1: 53,196,976 L715R probably damaging Het
Prkd1 T C 12: 50,394,994 N254S probably benign Het
Prkdc T C 16: 15,835,913 V3868A possibly damaging Het
Ptprt T C 2: 161,927,640 N435S probably benign Het
Purb T C 11: 6,474,943 E315G unknown Het
Rap1b A T 10: 117,818,586 N116K probably damaging Het
Rp1l1 A G 14: 64,029,593 N876S probably benign Het
Rps6ka4 T A 19: 6,839,466 I114F probably damaging Het
Sh3bp2 A G 5: 34,551,619 N19D probably damaging Het
Slc16a4 A G 3: 107,301,001 M276V probably benign Het
Slc17a1 A G 13: 23,875,881 T172A probably benign Het
Slc4a7 C T 14: 14,748,581 A320V probably damaging Het
Slco1a6 T A 6: 142,133,230 Y113F probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
St3gal6 A T 16: 58,473,561 probably null Het
Tdp2 A G 13: 24,841,277 D343G probably benign Het
Tecpr2 T A 12: 110,933,169 L657Q probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Trappc6a T A 7: 19,514,501 F28I probably damaging Het
Trim32 G A 4: 65,614,066 V287I probably benign Het
Trpd52l3 T C 19: 30,003,889 S15P probably damaging Het
Tsnaxip1 A G 8: 105,840,038 I169V probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttll11 T A 2: 35,940,753 Q18L probably null Het
Ttll8 A T 15: 88,915,486 I584N probably damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ucp3 T C 7: 100,480,664 V171A probably benign Het
Vmn1r174 T A 7: 23,754,107 I66N probably damaging Het
Vmn2r13 T C 5: 109,191,986 D41G possibly damaging Het
Vmn2r4 T C 3: 64,398,555 D393G probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp976 C A 7: 42,613,681 C244F unknown Het
Zmym5 A G 14: 56,799,120 V190A probably damaging Het
Other mutations in Adam22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Adam22 APN 5 8127333 missense probably benign 0.44
IGL01368:Adam22 APN 5 8127411 missense probably damaging 1.00
IGL01406:Adam22 APN 5 8130212 nonsense probably null
IGL01463:Adam22 APN 5 8092790 missense probably damaging 1.00
IGL01691:Adam22 APN 5 8092742 missense probably damaging 1.00
IGL01798:Adam22 APN 5 8232604 splice site probably null
IGL01975:Adam22 APN 5 8167396 missense probably damaging 1.00
IGL02076:Adam22 APN 5 8136900 missense probably damaging 1.00
IGL02170:Adam22 APN 5 8134845 missense probably benign
IGL02189:Adam22 APN 5 8330029 missense possibly damaging 0.91
IGL02859:Adam22 APN 5 8167375 missense probably damaging 1.00
IGL03189:Adam22 APN 5 8111897 nonsense probably null
IGL03326:Adam22 APN 5 8127421 missense probably damaging 1.00
IGL03329:Adam22 APN 5 8149210 missense possibly damaging 0.48
IGL03354:Adam22 APN 5 8158890 missense possibly damaging 0.82
IGL03394:Adam22 APN 5 8167379 missense probably benign 0.00
IGL03047:Adam22 UTSW 5 8082220 missense probably damaging 1.00
R0445:Adam22 UTSW 5 8180591 intron probably benign
R0486:Adam22 UTSW 5 8330048 missense probably damaging 1.00
R0669:Adam22 UTSW 5 8143036 splice site probably benign
R0866:Adam22 UTSW 5 8082156 missense probably damaging 0.98
R1510:Adam22 UTSW 5 8152408 missense probably benign 0.06
R1562:Adam22 UTSW 5 8095007 missense probably damaging 1.00
R1640:Adam22 UTSW 5 8145689 missense probably damaging 1.00
R1903:Adam22 UTSW 5 8134525 missense probably damaging 1.00
R1998:Adam22 UTSW 5 8329995 missense probably damaging 1.00
R2012:Adam22 UTSW 5 8117634 missense probably damaging 1.00
R2214:Adam22 UTSW 5 8136805 critical splice donor site probably null
R2270:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2271:Adam22 UTSW 5 8121108 missense probably damaging 0.98
R2286:Adam22 UTSW 5 8145616 missense probably damaging 1.00
R2304:Adam22 UTSW 5 8092366 missense probably damaging 1.00
R2406:Adam22 UTSW 5 8180064 intron probably benign
R2656:Adam22 UTSW 5 8117696 missense probably damaging 1.00
R3106:Adam22 UTSW 5 8117583 splice site probably null
R3870:Adam22 UTSW 5 8132418 missense probably damaging 1.00
R3923:Adam22 UTSW 5 8130514 missense possibly damaging 0.68
R4092:Adam22 UTSW 5 8095004 missense probably damaging 1.00
R4180:Adam22 UTSW 5 8149218 missense probably damaging 1.00
R4247:Adam22 UTSW 5 8145626 missense probably benign
R4486:Adam22 UTSW 5 8180227 intron probably benign
R4629:Adam22 UTSW 5 8232663 missense possibly damaging 0.95
R4744:Adam22 UTSW 5 8078699 missense probably damaging 0.98
R4839:Adam22 UTSW 5 8136813 missense probably damaging 1.00
R5007:Adam22 UTSW 5 8167393 missense probably damaging 1.00
R5030:Adam22 UTSW 5 8179645 intron probably benign
R5061:Adam22 UTSW 5 8180238 intron probably benign
R5312:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5353:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5354:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5356:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5423:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5424:Adam22 UTSW 5 8090182 missense probably damaging 1.00
R5719:Adam22 UTSW 5 8367217 missense probably benign
R5763:Adam22 UTSW 5 8134544 missense probably damaging 1.00
R5768:Adam22 UTSW 5 8127426 missense probably benign 0.35
R5776:Adam22 UTSW 5 8127361 missense probably benign 0.26
R5839:Adam22 UTSW 5 8136861 missense probably damaging 0.99
R6314:Adam22 UTSW 5 8127365 nonsense probably null
R6520:Adam22 UTSW 5 8116635 missense probably damaging 0.98
R6798:Adam22 UTSW 5 8160784 missense probably damaging 1.00
R6924:Adam22 UTSW 5 8367322 missense possibly damaging 0.78
R6938:Adam22 UTSW 5 8146499 missense probably benign 0.01
R7317:Adam22 UTSW 5 8090202 missense probably benign
R7402:Adam22 UTSW 5 8095049 missense possibly damaging 0.95
R7431:Adam22 UTSW 5 8092818 missense probably damaging 1.00
R7527:Adam22 UTSW 5 8082239 missense possibly damaging 0.66
R7571:Adam22 UTSW 5 8082160 nonsense probably null
R7627:Adam22 UTSW 5 8367933 missense probably benign
R7714:Adam22 UTSW 5 8117587 critical splice donor site probably null
R7806:Adam22 UTSW 5 8092825 missense probably damaging 1.00
X0067:Adam22 UTSW 5 8127329 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTCATGATGCAGGTGCTAGAG -3'
(R):5'- CGCTTTGCTCTAGTATGCCG -3'

Sequencing Primer
(F):5'- GCTAGAGGAACCCTTGCCTTC -3'
(R):5'- GCTCTAGTATGCCGTCCTTTATTC -3'
Posted On2014-07-14