Incidental Mutation 'R1939:Sh3bp2'
ID213801
Institutional Source Beutler Lab
Gene Symbol Sh3bp2
Ensembl Gene ENSMUSG00000054520
Gene NameSH3-domain binding protein 2
Synonyms3BP2
MMRRC Submission 039957-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1939 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34525838-34563641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34551619 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 19 (N19D)
Ref Sequence ENSEMBL: ENSMUSP00000136671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067638] [ENSMUST00000101316] [ENSMUST00000118545] [ENSMUST00000125817] [ENSMUST00000138912] [ENSMUST00000179943]
Predicted Effect probably damaging
Transcript: ENSMUST00000067638
AA Change: N19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070890
Gene: ENSMUSG00000054520
AA Change: N19D

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101316
AA Change: N63D

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098874
Gene: ENSMUSG00000054520
AA Change: N63D

DomainStartEndE-ValueType
PH 71 176 1.33e-18 SMART
low complexity region 185 195 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 244 260 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
low complexity region 414 429 N/A INTRINSIC
SH2 497 586 2.04e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118545
AA Change: N75D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112554
Gene: ENSMUSG00000054520
AA Change: N75D

DomainStartEndE-ValueType
PH 83 188 1.33e-18 SMART
low complexity region 197 207 N/A INTRINSIC
low complexity region 226 241 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
SH2 509 598 2.04e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125817
AA Change: N19D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000138912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153750
Predicted Effect probably damaging
Transcript: ENSMUST00000179943
AA Change: N19D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136671
Gene: ENSMUSG00000054520
AA Change: N19D

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202745
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has an N-terminal pleckstrin homology (PH) domain, an SH3-binding proline-rich region, and a C-terminal SH2 domain. The protein binds to the SH3 domains of several proteins including the ABL1 and SYK protein tyrosine kinases , and functions as a cytoplasmic adaptor protein to positively regulate transcriptional activity in T, natural killer (NK), and basophilic cells. Mutations in this gene result in cherubism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Nullizygous mutations may lead to higher pre-B cell numbers and impaired B cell receptor signaling or thymus-independent type 2 humoral responses. Homozygosity for a knock-in allele causes premature death, enhanced osteoclast differentiation and TNF production, systemic bone loss and inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,304 W11R probably damaging Het
2700049A03Rik A G 12: 71,160,412 probably null Het
3110002H16Rik T C 18: 12,180,505 L15P probably damaging Het
4933409G03Rik T C 2: 68,588,984 S26P possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acot3 A G 12: 84,058,551 N264S probably benign Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam22 A T 5: 8,330,015 F94L probably damaging Het
Adarb2 T C 13: 8,203,322 probably null Het
Aldh1b1 A G 4: 45,802,755 M98V possibly damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atp8b3 A T 10: 80,525,386 C785* probably null Het
Birc6 T C 17: 74,670,337 S4362P probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cntnap5b A G 1: 99,967,348 H115R probably benign Het
Col23a1 A G 11: 51,551,989 D159G unknown Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Dnase2a G T 8: 84,910,895 A309S possibly damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Engase T A 11: 118,479,186 N97K probably damaging Het
Fam83b A T 9: 76,493,080 M247K probably damaging Het
Fer T C 17: 63,973,128 S65P probably damaging Het
Fgf10 A G 13: 118,789,152 R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5415 T C 1: 32,545,546 I428V probably damaging Het
Gm904 T C 13: 50,644,736 probably null Het
Gpat2 T A 2: 127,435,959 *802K probably null Het
Hcfc2 G T 10: 82,702,450 R107L probably damaging Het
Itga8 T G 2: 12,300,846 D111A probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lgals8 T G 13: 12,459,188 I10L probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Mcpt1 A T 14: 56,019,089 K94I possibly damaging Het
Mpnd T C 17: 56,015,920 F384S probably damaging Het
Mrgprb5 A T 7: 48,168,938 N16K probably benign Het
Myo15b A G 11: 115,887,703 T1139A probably benign Het
Nat8f5 A C 6: 85,817,819 I53R possibly damaging Het
Nav1 A T 1: 135,465,898 L1034Q probably damaging Het
Nudt6 T C 3: 37,405,230 Y54C probably damaging Het
Olfr1404 G T 1: 173,215,932 A94S probably benign Het
Olfr482 A G 7: 108,095,141 V143A probably benign Het
Olfr815 A C 10: 129,902,101 M203R probably damaging Het
Olfr881 A G 9: 37,993,089 N199S probably benign Het
Olfr893 T A 9: 38,209,429 Y72* probably null Het
Osbpl8 A T 10: 111,289,811 H784L probably benign Het
Osr1 T G 12: 9,579,687 S187A probably damaging Het
Pcdhgc5 A G 18: 37,821,950 Y759C probably damaging Het
Pkd1l2 G T 8: 117,046,182 Y1035* probably null Het
Pla2g15 A G 8: 106,163,295 T400A probably damaging Het
Pms1 A C 1: 53,196,976 L715R probably damaging Het
Prkd1 T C 12: 50,394,994 N254S probably benign Het
Prkdc T C 16: 15,835,913 V3868A possibly damaging Het
Ptprt T C 2: 161,927,640 N435S probably benign Het
Purb T C 11: 6,474,943 E315G unknown Het
Rap1b A T 10: 117,818,586 N116K probably damaging Het
Rp1l1 A G 14: 64,029,593 N876S probably benign Het
Rps6ka4 T A 19: 6,839,466 I114F probably damaging Het
Slc16a4 A G 3: 107,301,001 M276V probably benign Het
Slc17a1 A G 13: 23,875,881 T172A probably benign Het
Slc4a7 C T 14: 14,748,581 A320V probably damaging Het
Slco1a6 T A 6: 142,133,230 Y113F probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
St3gal6 A T 16: 58,473,561 probably null Het
Tdp2 A G 13: 24,841,277 D343G probably benign Het
Tecpr2 T A 12: 110,933,169 L657Q probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Trappc6a T A 7: 19,514,501 F28I probably damaging Het
Trim32 G A 4: 65,614,066 V287I probably benign Het
Trpd52l3 T C 19: 30,003,889 S15P probably damaging Het
Tsnaxip1 A G 8: 105,840,038 I169V probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttll11 T A 2: 35,940,753 Q18L probably null Het
Ttll8 A T 15: 88,915,486 I584N probably damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ucp3 T C 7: 100,480,664 V171A probably benign Het
Vmn1r174 T A 7: 23,754,107 I66N probably damaging Het
Vmn2r13 T C 5: 109,191,986 D41G possibly damaging Het
Vmn2r4 T C 3: 64,398,555 D393G probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp976 C A 7: 42,613,681 C244F unknown Het
Zmym5 A G 14: 56,799,120 V190A probably damaging Het
Other mutations in Sh3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Sh3bp2 APN 5 34556003 missense probably damaging 0.99
IGL02478:Sh3bp2 APN 5 34551662 missense probably damaging 1.00
IGL03196:Sh3bp2 APN 5 34557343 missense probably damaging 1.00
IGL03329:Sh3bp2 APN 5 34559202 missense probably benign 0.00
R0718:Sh3bp2 UTSW 5 34555495 missense probably damaging 0.99
R1322:Sh3bp2 UTSW 5 34555493 missense probably damaging 1.00
R1501:Sh3bp2 UTSW 5 34555576 critical splice donor site probably null
R1573:Sh3bp2 UTSW 5 34560690 missense probably benign 0.01
R1649:Sh3bp2 UTSW 5 34559004 missense possibly damaging 0.61
R2021:Sh3bp2 UTSW 5 34544225 critical splice acceptor site probably benign
R2372:Sh3bp2 UTSW 5 34559496 missense probably benign 0.00
R2903:Sh3bp2 UTSW 5 34543556 nonsense probably null
R3709:Sh3bp2 UTSW 5 34551658 missense probably damaging 1.00
R4344:Sh3bp2 UTSW 5 34555542 missense possibly damaging 0.86
R4391:Sh3bp2 UTSW 5 34549718 missense probably benign
R5068:Sh3bp2 UTSW 5 34556967 missense probably benign 0.00
R5637:Sh3bp2 UTSW 5 34561048 missense possibly damaging 0.69
R5658:Sh3bp2 UTSW 5 34556947 missense probably damaging 1.00
R6005:Sh3bp2 UTSW 5 34562465 missense possibly damaging 0.65
R6014:Sh3bp2 UTSW 5 34559627 missense probably benign 0.00
R6391:Sh3bp2 UTSW 5 34561603 missense probably damaging 1.00
R6737:Sh3bp2 UTSW 5 34562474 missense probably damaging 1.00
R7144:Sh3bp2 UTSW 5 34561631 missense probably benign 0.00
R7536:Sh3bp2 UTSW 5 34543557 missense probably benign
R7871:Sh3bp2 UTSW 5 34559085 missense not run
R7954:Sh3bp2 UTSW 5 34559085 missense not run
Predicted Primers PCR Primer
(F):5'- CTCAGAAGCCTGGGGACTTATG -3'
(R):5'- TGTGCCAGCTGCTAGAAAAGG -3'

Sequencing Primer
(F):5'- GGGACTTATGAAGAGTCCTCCTC -3'
(R):5'- GGAAAAGAAATCTCAGGAGACCCAC -3'
Posted On2014-07-14