Mutagenetix > Incidental Mutation

Incidental Mutation 'R1939:Ucp3'

213811

Institutional Source

Beutler Lab

Gene Symbol

Ucp3

Ensembl Gene

ENSMUSG00000032942

Gene Name

uncoupling protein 3 (mitochondrial, proton carrier)

Synonyms

UCP-3, Slc25a9

MMRRC Submission

039957-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R1939 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100472990-100486432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 100480664 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 171 (V171A)

Ref Sequence

ENSEMBL: ENSMUSP00000102674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032958] [ENSMUST00000107059]

AlphaFold

P56501

Predicted Effect

probably benign
Transcript: ENSMUST00000032958
AA Change: V171A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000032958
Gene: ENSMUSG00000032942
AA Change: V171A

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	10	107	3.1e-20	PFAM
Pfam:Mito_carr	109	207	9.6e-26	PFAM
Pfam:Mito_carr	210	301	2.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107059
AA Change: V171A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000102674
Gene: ENSMUSG00000032942
AA Change: V171A

Domain	Start	End	E-Value	Type
Pfam:Mito_carr	9	107	5.9e-22	PFAM
Pfam:Mito_carr	109	207	1.7e-27	PFAM
Pfam:Mito_carr	209	301	9.4e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128044

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133850

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. The different UCPs have tissue-specific expression; this gene is primarily expressed in skeletal muscle. This gene's protein product is postulated to protect mitochondria against lipid-induced oxidative stress. Expression levels of this gene increase when fatty acid supplies to mitochondria exceed their oxidation capacity and the protein enables the export of fatty acids from mitochondria. UCPs contain the three solcar protein domains typically found in MACPs. Two splice variants have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutants exhibit a lack of superoxide-induced uncoupling in skeletal muscle mitochondria, accompanied by increased reactive oxygen species formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L24Rik	T	A	11: 83,440,304	W11R	probably damaging	Het
2700049A03Rik	A	G	12: 71,160,412		probably null	Het
3110002H16Rik	T	C	18: 12,180,505	L15P	probably damaging	Het
4933409G03Rik	T	C	2: 68,588,984	S26P	possibly damaging	Het
9930021J03Rik	A	G	19: 29,753,677	F712S	possibly damaging	Het
Ace2	A	T	X: 164,156,528	M123L	possibly damaging	Het
Acot3	A	G	12: 84,058,551	N264S	probably benign	Het
Acvr1c	A	T	2: 58,283,505	N248K	probably damaging	Het
Adam22	A	T	5: 8,330,015	F94L	probably damaging	Het
Adarb2	T	C	13: 8,203,322		probably null	Het
Aldh1b1	A	G	4: 45,802,755	M98V	possibly damaging	Het
Arfgef2	T	A	2: 166,873,628	V1331D	probably damaging	Het
Atf2	G	A	2: 73,846,219	P184S	probably damaging	Het
Atp8b3	A	T	10: 80,525,386	C785*	probably null	Het
Birc6	T	C	17: 74,670,337	S4362P	probably damaging	Het
Chn1	A	G	2: 73,624,901	C39R	probably damaging	Het
Cngb1	C	A	8: 95,299,692	G154W	probably damaging	Het
Cntnap5b	A	G	1: 99,967,348	H115R	probably benign	Het
Col23a1	A	G	11: 51,551,989	D159G	unknown	Het
Coro7	T	C	16: 4,628,732	E843G	probably benign	Het
Dnase2a	G	T	8: 84,910,895	A309S	possibly damaging	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Engase	T	A	11: 118,479,186	N97K	probably damaging	Het
Fam83b	A	T	9: 76,493,080	M247K	probably damaging	Het
Fer	T	C	17: 63,973,128	S65P	probably damaging	Het
Fgf10	A	G	13: 118,789,152	R156G	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm5415	T	C	1: 32,545,546	I428V	probably damaging	Het
Gm904	T	C	13: 50,644,736		probably null	Het
Gpat2	T	A	2: 127,435,959	*802K	probably null	Het
Hcfc2	G	T	10: 82,702,450	R107L	probably damaging	Het
Itga8	T	G	2: 12,300,846	D111A	probably damaging	Het
Jag1	C	G	2: 137,083,473	V1070L	possibly damaging	Het
Lama5	T	C	2: 180,190,921	N1646S	probably benign	Het
Lgals8	T	G	13: 12,459,188	I10L	probably benign	Het
Lrp1b	A	G	2: 40,697,589	S116P	unknown	Het
Mcpt1	A	T	14: 56,019,089	K94I	possibly damaging	Het
Mpnd	T	C	17: 56,015,920	F384S	probably damaging	Het
Mrgprb5	A	T	7: 48,168,938	N16K	probably benign	Het
Myo15b	A	G	11: 115,887,703	T1139A	probably benign	Het
Nat8f5	A	C	6: 85,817,819	I53R	possibly damaging	Het
Nav1	A	T	1: 135,465,898	L1034Q	probably damaging	Het
Nudt6	T	C	3: 37,405,230	Y54C	probably damaging	Het
Olfr1404	G	T	1: 173,215,932	A94S	probably benign	Het
Olfr482	A	G	7: 108,095,141	V143A	probably benign	Het
Olfr815	A	C	10: 129,902,101	M203R	probably damaging	Het
Olfr881	A	G	9: 37,993,089	N199S	probably benign	Het
Olfr893	T	A	9: 38,209,429	Y72*	probably null	Het
Osbpl8	A	T	10: 111,289,811	H784L	probably benign	Het
Osr1	T	G	12: 9,579,687	S187A	probably damaging	Het
Pcdhgc5	A	G	18: 37,821,950	Y759C	probably damaging	Het
Pkd1l2	G	T	8: 117,046,182	Y1035*	probably null	Het
Pla2g15	A	G	8: 106,163,295	T400A	probably damaging	Het
Pms1	A	C	1: 53,196,976	L715R	probably damaging	Het
Prkd1	T	C	12: 50,394,994	N254S	probably benign	Het
Prkdc	T	C	16: 15,835,913	V3868A	possibly damaging	Het
Ptprt	T	C	2: 161,927,640	N435S	probably benign	Het
Purb	T	C	11: 6,474,943	E315G	unknown	Het
Rap1b	A	T	10: 117,818,586	N116K	probably damaging	Het
Rp1l1	A	G	14: 64,029,593	N876S	probably benign	Het
Rps6ka4	T	A	19: 6,839,466	I114F	probably damaging	Het
Sh3bp2	A	G	5: 34,551,619	N19D	probably damaging	Het
Slc16a4	A	G	3: 107,301,001	M276V	probably benign	Het
Slc17a1	A	G	13: 23,875,881	T172A	probably benign	Het
Slc4a7	C	T	14: 14,748,581	A320V	probably damaging	Het
Slco1a6	T	A	6: 142,133,230	Y113F	probably damaging	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
St3gal6	A	T	16: 58,473,561		probably null	Het
Tdp2	A	G	13: 24,841,277	D343G	probably benign	Het
Tecpr2	T	A	12: 110,933,169	L657Q	probably damaging	Het
Tet2	T	C	3: 133,488,638	T12A	possibly damaging	Het
Trappc6a	T	A	7: 19,514,501	F28I	probably damaging	Het
Trim32	G	A	4: 65,614,066	V287I	probably benign	Het
Trpd52l3	T	C	19: 30,003,889	S15P	probably damaging	Het
Tsnaxip1	A	G	8: 105,840,038	I169V	probably benign	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ttll11	T	A	2: 35,940,753	Q18L	probably null	Het
Ttll8	A	T	15: 88,915,486	I584N	probably damaging	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Vmn1r174	T	A	7: 23,754,107	I66N	probably damaging	Het
Vmn2r13	T	C	5: 109,191,986	D41G	possibly damaging	Het
Vmn2r4	T	C	3: 64,398,555	D393G	probably benign	Het
Wipf2	C	T	11: 98,892,410	R221*	probably null	Het
Zfp976	C	A	7: 42,613,681	C244F	unknown	Het
Zmym5	A	G	14: 56,799,120	V190A	probably damaging	Het

Other mutations in Ucp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02016:Ucp3	APN	7	100480559	missense	probably damaging	1.00
IGL02883:Ucp3	APN	7	100480642	missense	probably benign	0.00
IGL03137:Ucp3	APN	7	100482762	splice site	probably benign
PIT4576001:Ucp3	UTSW	7	100480251	missense	probably benign	0.04
R0023:Ucp3	UTSW	7	100485043	missense	probably benign	0.00
R0023:Ucp3	UTSW	7	100485043	missense	probably benign	0.00
R0532:Ucp3	UTSW	7	100481979	splice site	probably benign
R0616:Ucp3	UTSW	7	100480161	missense	probably benign	0.00
R0833:Ucp3	UTSW	7	100479541	nonsense	probably null
R1739:Ucp3	UTSW	7	100482720	missense	probably benign	0.01
R3861:Ucp3	UTSW	7	100480251	missense	probably benign	0.04
R3958:Ucp3	UTSW	7	100482739	missense	probably benign	0.00
R3959:Ucp3	UTSW	7	100482739	missense	probably benign	0.00
R4059:Ucp3	UTSW	7	100482664	missense	probably damaging	0.99
R5535:Ucp3	UTSW	7	100480666	missense	probably benign	0.45
R6463:Ucp3	UTSW	7	100480269	missense	probably benign	0.00
R6596:Ucp3	UTSW	7	100481933	missense	probably benign	0.01
R7517:Ucp3	UTSW	7	100481882	missense	probably damaging	1.00
R7693:Ucp3	UTSW	7	100482592	missense	probably benign	0.00
R9487:Ucp3	UTSW	7	100481916	missense	probably damaging	1.00
R9493:Ucp3	UTSW	7	100482704	missense	probably benign	0.00
Z1177:Ucp3	UTSW	7	100480592	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- ACTGGTGAGATTCTGACAGTGTC -3'
(R):5'- ACACTATTTGACGTCCTGTGG -3'

Sequencing Primer
(F):5'- GACAGTGTCAGAGACTCCTAGTTC -3'
(R):5'- TGACGTCCTGTGGCCAGTG -3'

Posted On

2014-07-14