Incidental Mutation 'R1939:Dnase2a'
ID213814
Institutional Source Beutler Lab
Gene Symbol Dnase2a
Ensembl Gene ENSMUSG00000003812
Gene Namedeoxyribonuclease II alpha
Synonyms
MMRRC Submission 039957-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1939 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84908560-84922915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84910895 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 309 (A309S)
Ref Sequence ENSEMBL: ENSMUSP00000003910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003910] [ENSMUST00000109741] [ENSMUST00000109744] [ENSMUST00000119820] [ENSMUST00000134569] [ENSMUST00000145292]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003910
AA Change: A309S

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003910
Gene: ENSMUSG00000003812
AA Change: A309S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 21 349 5.8e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109741
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109744
AA Change: A288S

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105366
Gene: ENSMUSG00000003812
AA Change: A288S

DomainStartEndE-ValueType
Pfam:DNase_II 9 328 4.8e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119820
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128400
Predicted Effect probably benign
Transcript: ENSMUST00000134569
SMART Domains Protein: ENSMUSP00000117198
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 119 6.6e-32 PFAM
Pfam:DNase_II 115 182 4.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135219
Predicted Effect probably benign
Transcript: ENSMUST00000145292
SMART Domains Protein: ENSMUSP00000138203
Gene: ENSMUSG00000003812

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DNase_II 20 97 2.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155942
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNase family. The protein, located in the lysosome, hydrolyzes DNA under acidic conditions and mediates the breakdown of DNA during erythropoiesis and apoptosis. Two codominant alleles have been characterized, DNASE2*L (low activity) and DNASE2*H (high activity), that differ at one nucleotide in the promoter region. The DNASE2*H allele is represented in this record. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutations of this gene result in perinatal death, anemia, and impaired definitive erythropoiesis in the fetal liver. Homozygotes for one null mutation display diaphragm abnormalities and asphyxiation, as well as a specific defect in the phagocytic phase of apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,304 W11R probably damaging Het
2700049A03Rik A G 12: 71,160,412 probably null Het
3110002H16Rik T C 18: 12,180,505 L15P probably damaging Het
4933409G03Rik T C 2: 68,588,984 S26P possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acot3 A G 12: 84,058,551 N264S probably benign Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam22 A T 5: 8,330,015 F94L probably damaging Het
Adarb2 T C 13: 8,203,322 probably null Het
Aldh1b1 A G 4: 45,802,755 M98V possibly damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atp8b3 A T 10: 80,525,386 C785* probably null Het
Birc6 T C 17: 74,670,337 S4362P probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cntnap5b A G 1: 99,967,348 H115R probably benign Het
Col23a1 A G 11: 51,551,989 D159G unknown Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Engase T A 11: 118,479,186 N97K probably damaging Het
Fam83b A T 9: 76,493,080 M247K probably damaging Het
Fer T C 17: 63,973,128 S65P probably damaging Het
Fgf10 A G 13: 118,789,152 R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5415 T C 1: 32,545,546 I428V probably damaging Het
Gm904 T C 13: 50,644,736 probably null Het
Gpat2 T A 2: 127,435,959 *802K probably null Het
Hcfc2 G T 10: 82,702,450 R107L probably damaging Het
Itga8 T G 2: 12,300,846 D111A probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lgals8 T G 13: 12,459,188 I10L probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Mcpt1 A T 14: 56,019,089 K94I possibly damaging Het
Mpnd T C 17: 56,015,920 F384S probably damaging Het
Mrgprb5 A T 7: 48,168,938 N16K probably benign Het
Myo15b A G 11: 115,887,703 T1139A probably benign Het
Nat8f5 A C 6: 85,817,819 I53R possibly damaging Het
Nav1 A T 1: 135,465,898 L1034Q probably damaging Het
Nudt6 T C 3: 37,405,230 Y54C probably damaging Het
Olfr1404 G T 1: 173,215,932 A94S probably benign Het
Olfr482 A G 7: 108,095,141 V143A probably benign Het
Olfr815 A C 10: 129,902,101 M203R probably damaging Het
Olfr881 A G 9: 37,993,089 N199S probably benign Het
Olfr893 T A 9: 38,209,429 Y72* probably null Het
Osbpl8 A T 10: 111,289,811 H784L probably benign Het
Osr1 T G 12: 9,579,687 S187A probably damaging Het
Pcdhgc5 A G 18: 37,821,950 Y759C probably damaging Het
Pkd1l2 G T 8: 117,046,182 Y1035* probably null Het
Pla2g15 A G 8: 106,163,295 T400A probably damaging Het
Pms1 A C 1: 53,196,976 L715R probably damaging Het
Prkd1 T C 12: 50,394,994 N254S probably benign Het
Prkdc T C 16: 15,835,913 V3868A possibly damaging Het
Ptprt T C 2: 161,927,640 N435S probably benign Het
Purb T C 11: 6,474,943 E315G unknown Het
Rap1b A T 10: 117,818,586 N116K probably damaging Het
Rp1l1 A G 14: 64,029,593 N876S probably benign Het
Rps6ka4 T A 19: 6,839,466 I114F probably damaging Het
Sh3bp2 A G 5: 34,551,619 N19D probably damaging Het
Slc16a4 A G 3: 107,301,001 M276V probably benign Het
Slc17a1 A G 13: 23,875,881 T172A probably benign Het
Slc4a7 C T 14: 14,748,581 A320V probably damaging Het
Slco1a6 T A 6: 142,133,230 Y113F probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
St3gal6 A T 16: 58,473,561 probably null Het
Tdp2 A G 13: 24,841,277 D343G probably benign Het
Tecpr2 T A 12: 110,933,169 L657Q probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Trappc6a T A 7: 19,514,501 F28I probably damaging Het
Trim32 G A 4: 65,614,066 V287I probably benign Het
Trpd52l3 T C 19: 30,003,889 S15P probably damaging Het
Tsnaxip1 A G 8: 105,840,038 I169V probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttll11 T A 2: 35,940,753 Q18L probably null Het
Ttll8 A T 15: 88,915,486 I584N probably damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ucp3 T C 7: 100,480,664 V171A probably benign Het
Vmn1r174 T A 7: 23,754,107 I66N probably damaging Het
Vmn2r13 T C 5: 109,191,986 D41G possibly damaging Het
Vmn2r4 T C 3: 64,398,555 D393G probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp976 C A 7: 42,613,681 C244F unknown Het
Zmym5 A G 14: 56,799,120 V190A probably damaging Het
Other mutations in Dnase2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Dnase2a UTSW 8 84908788 unclassified probably benign
R0211:Dnase2a UTSW 8 84908788 unclassified probably benign
R0396:Dnase2a UTSW 8 84909763 splice site probably benign
R1845:Dnase2a UTSW 8 84909322 missense probably benign 0.19
R1870:Dnase2a UTSW 8 84908763 start gained probably benign
R2113:Dnase2a UTSW 8 84910871 missense probably damaging 0.99
R2442:Dnase2a UTSW 8 84908993 missense probably damaging 1.00
R4815:Dnase2a UTSW 8 84909877 missense probably benign 0.12
R4913:Dnase2a UTSW 8 84908848 missense probably damaging 1.00
R4922:Dnase2a UTSW 8 84908996 unclassified probably null
R5183:Dnase2a UTSW 8 84909578 intron probably benign
R6239:Dnase2a UTSW 8 84908879 splice site probably null
R6951:Dnase2a UTSW 8 84909625 missense possibly damaging 0.93
R7215:Dnase2a UTSW 8 84909770 critical splice acceptor site probably null
R7789:Dnase2a UTSW 8 84908876 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATGTACCAGTGGCCCTCAC -3'
(R):5'- GCGGAGTCTTAGTCCTTTGCTC -3'

Sequencing Primer
(F):5'- CAGACCTGTACTCCGGATGGTTG -3'
(R):5'- TCCGATGGGCTTCAGTCAG -3'
Posted On2014-07-14