Incidental Mutation 'R1939:Cngb1'
ID213816
Institutional Source Beutler Lab
Gene Symbol Cngb1
Ensembl Gene ENSMUSG00000031789
Gene Namecyclic nucleotide gated channel beta 1
SynonymsBC016201, Cngb1b, Cngb1
MMRRC Submission 039957-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1939 (G1)
Quality Score195
Status Not validated
Chromosome8
Chromosomal Location95239045-95306585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 95299692 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 154 (G154W)
Ref Sequence ENSEMBL: ENSMUSP00000148290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093268] [ENSMUST00000119870] [ENSMUST00000133716] [ENSMUST00000134207] [ENSMUST00000156514]
Predicted Effect probably damaging
Transcript: ENSMUST00000093268
AA Change: G154W

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090956
Gene: ENSMUSG00000031789
AA Change: G154W

DomainStartEndE-ValueType
low complexity region 33 103 N/A INTRINSIC
low complexity region 248 267 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119870
AA Change: G154W
SMART Domains Protein: ENSMUSP00000113827
Gene: ENSMUSG00000031789
AA Change: G154W

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
Pfam:Ion_trans 83 315 9.8e-17 PFAM
cNMP 389 508 4.1e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133716
AA Change: G154W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000134207
AA Change: G154W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000156514
AA Change: G154W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000212237
AA Change: G33W
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display postnatal lethality, reduced body size and weight, and retinal rod degeneration followed by cone degeneration. Mice homozygous for an allele lacking the calmodulin-binding domain exhibit defective olfactory neural signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,304 W11R probably damaging Het
2700049A03Rik A G 12: 71,160,412 probably null Het
3110002H16Rik T C 18: 12,180,505 L15P probably damaging Het
4933409G03Rik T C 2: 68,588,984 S26P possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acot3 A G 12: 84,058,551 N264S probably benign Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam22 A T 5: 8,330,015 F94L probably damaging Het
Adarb2 T C 13: 8,203,322 probably null Het
Aldh1b1 A G 4: 45,802,755 M98V possibly damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atp8b3 A T 10: 80,525,386 C785* probably null Het
Birc6 T C 17: 74,670,337 S4362P probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Cntnap5b A G 1: 99,967,348 H115R probably benign Het
Col23a1 A G 11: 51,551,989 D159G unknown Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Dnase2a G T 8: 84,910,895 A309S possibly damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Engase T A 11: 118,479,186 N97K probably damaging Het
Fam83b A T 9: 76,493,080 M247K probably damaging Het
Fer T C 17: 63,973,128 S65P probably damaging Het
Fgf10 A G 13: 118,789,152 R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5415 T C 1: 32,545,546 I428V probably damaging Het
Gm904 T C 13: 50,644,736 probably null Het
Gpat2 T A 2: 127,435,959 *802K probably null Het
Hcfc2 G T 10: 82,702,450 R107L probably damaging Het
Itga8 T G 2: 12,300,846 D111A probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lgals8 T G 13: 12,459,188 I10L probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Mcpt1 A T 14: 56,019,089 K94I possibly damaging Het
Mpnd T C 17: 56,015,920 F384S probably damaging Het
Mrgprb5 A T 7: 48,168,938 N16K probably benign Het
Myo15b A G 11: 115,887,703 T1139A probably benign Het
Nat8f5 A C 6: 85,817,819 I53R possibly damaging Het
Nav1 A T 1: 135,465,898 L1034Q probably damaging Het
Nudt6 T C 3: 37,405,230 Y54C probably damaging Het
Olfr1404 G T 1: 173,215,932 A94S probably benign Het
Olfr482 A G 7: 108,095,141 V143A probably benign Het
Olfr815 A C 10: 129,902,101 M203R probably damaging Het
Olfr881 A G 9: 37,993,089 N199S probably benign Het
Olfr893 T A 9: 38,209,429 Y72* probably null Het
Osbpl8 A T 10: 111,289,811 H784L probably benign Het
Osr1 T G 12: 9,579,687 S187A probably damaging Het
Pcdhgc5 A G 18: 37,821,950 Y759C probably damaging Het
Pkd1l2 G T 8: 117,046,182 Y1035* probably null Het
Pla2g15 A G 8: 106,163,295 T400A probably damaging Het
Pms1 A C 1: 53,196,976 L715R probably damaging Het
Prkd1 T C 12: 50,394,994 N254S probably benign Het
Prkdc T C 16: 15,835,913 V3868A possibly damaging Het
Ptprt T C 2: 161,927,640 N435S probably benign Het
Purb T C 11: 6,474,943 E315G unknown Het
Rap1b A T 10: 117,818,586 N116K probably damaging Het
Rp1l1 A G 14: 64,029,593 N876S probably benign Het
Rps6ka4 T A 19: 6,839,466 I114F probably damaging Het
Sh3bp2 A G 5: 34,551,619 N19D probably damaging Het
Slc16a4 A G 3: 107,301,001 M276V probably benign Het
Slc17a1 A G 13: 23,875,881 T172A probably benign Het
Slc4a7 C T 14: 14,748,581 A320V probably damaging Het
Slco1a6 T A 6: 142,133,230 Y113F probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
St3gal6 A T 16: 58,473,561 probably null Het
Tdp2 A G 13: 24,841,277 D343G probably benign Het
Tecpr2 T A 12: 110,933,169 L657Q probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Trappc6a T A 7: 19,514,501 F28I probably damaging Het
Trim32 G A 4: 65,614,066 V287I probably benign Het
Trpd52l3 T C 19: 30,003,889 S15P probably damaging Het
Tsnaxip1 A G 8: 105,840,038 I169V probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttll11 T A 2: 35,940,753 Q18L probably null Het
Ttll8 A T 15: 88,915,486 I584N probably damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ucp3 T C 7: 100,480,664 V171A probably benign Het
Vmn1r174 T A 7: 23,754,107 I66N probably damaging Het
Vmn2r13 T C 5: 109,191,986 D41G possibly damaging Het
Vmn2r4 T C 3: 64,398,555 D393G probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp976 C A 7: 42,613,681 C244F unknown Het
Zmym5 A G 14: 56,799,120 V190A probably damaging Het
Other mutations in Cngb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cngb1 APN 8 95242184 splice site probably benign
IGL01575:Cngb1 APN 8 95264520 missense possibly damaging 0.51
IGL02329:Cngb1 APN 8 95242359 missense probably benign 0.14
IGL03332:Cngb1 APN 8 95298846 splice site probably benign
IGL03391:Cngb1 APN 8 95303705 unclassified probably benign
stevie UTSW 8 95260130 missense probably damaging 1.00
R0078:Cngb1 UTSW 8 95264545 critical splice acceptor site probably null
R0116:Cngb1 UTSW 8 95260638 missense probably damaging 1.00
R1073:Cngb1 UTSW 8 95303567 critical splice donor site probably null
R1166:Cngb1 UTSW 8 95260181 missense probably damaging 0.99
R1714:Cngb1 UTSW 8 95257931 missense probably damaging 1.00
R1753:Cngb1 UTSW 8 95297773 critical splice donor site probably benign
R1760:Cngb1 UTSW 8 95299700 missense probably benign 0.03
R1833:Cngb1 UTSW 8 95242355 missense probably damaging 1.00
R1935:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R1940:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R2045:Cngb1 UTSW 8 95297085 splice site probably null
R2379:Cngb1 UTSW 8 95260130 missense probably damaging 1.00
R2940:Cngb1 UTSW 8 95252107 missense probably benign 0.44
R4034:Cngb1 UTSW 8 95264450 missense possibly damaging 0.47
R4058:Cngb1 UTSW 8 95267654 missense probably benign 0.00
R4425:Cngb1 UTSW 8 95299716 missense probably damaging 1.00
R4585:Cngb1 UTSW 8 95297128 critical splice acceptor site probably null
R4591:Cngb1 UTSW 8 95253384 missense probably damaging 1.00
R4638:Cngb1 UTSW 8 95266019 missense probably damaging 1.00
R4906:Cngb1 UTSW 8 95251973 missense probably damaging 0.96
R4950:Cngb1 UTSW 8 95248507 missense probably damaging 1.00
R4979:Cngb1 UTSW 8 95259157 missense probably damaging 0.99
R5148:Cngb1 UTSW 8 95265983 missense probably benign 0.28
R5474:Cngb1 UTSW 8 95251969 missense probably damaging 1.00
R5475:Cngb1 UTSW 8 95251969 missense probably damaging 1.00
R5545:Cngb1 UTSW 8 95252173 missense probably damaging 1.00
R5585:Cngb1 UTSW 8 95263139 missense probably damaging 1.00
R5637:Cngb1 UTSW 8 95257921 missense probably damaging 1.00
R5785:Cngb1 UTSW 8 95254195 missense possibly damaging 0.90
R5967:Cngb1 UTSW 8 95251906 missense probably damaging 1.00
R6013:Cngb1 UTSW 8 95284321 unclassified probably benign
R6049:Cngb1 UTSW 8 95270842 missense probably damaging 0.99
R6370:Cngb1 UTSW 8 95264422 missense probably benign 0.33
R6377:Cngb1 UTSW 8 95248980 missense probably damaging 1.00
R6401:Cngb1 UTSW 8 95303739 unclassified probably benign
R6427:Cngb1 UTSW 8 95297759 intron probably benign
R6492:Cngb1 UTSW 8 95264424 missense probably benign 0.01
R6613:Cngb1 UTSW 8 95266010 missense possibly damaging 0.95
R6721:Cngb1 UTSW 8 95270888 missense probably benign 0.05
R6919:Cngb1 UTSW 8 95248375 missense probably null 1.00
R7012:Cngb1 UTSW 8 95257955 missense possibly damaging 0.83
R7418:Cngb1 UTSW 8 95278259 nonsense probably null
R7464:Cngb1 UTSW 8 95254183 missense possibly damaging 0.92
R7806:Cngb1 UTSW 8 95298804 critical splice donor site probably null
R8048:Cngb1 UTSW 8 95263210 missense not run
R8074:Cngb1 UTSW 8 95252173 missense probably damaging 1.00
RF010:Cngb1 UTSW 8 95303650 frame shift probably null
RF053:Cngb1 UTSW 8 95303648 frame shift probably null
T0722:Cngb1 UTSW 8 95296650 missense probably benign 0.02
T0722:Cngb1 UTSW 8 95297819 missense probably damaging 0.99
T0722:Cngb1 UTSW 8 95303696 unclassified probably benign
T0722:Cngb1 UTSW 8 95303714 unclassified probably benign
Z1177:Cngb1 UTSW 8 95252136 missense not run
Predicted Primers PCR Primer
(F):5'- CCCTGGAAAGACATTCTGCC -3'
(R):5'- GAGATAGTGGCTTGATCCATGTC -3'

Sequencing Primer
(F):5'- GGAAAGACATTCTGCCTCTTTG -3'
(R):5'- AGTGGCTTGATCCATGTCAAATCC -3'
Posted On2014-07-14