Incidental Mutation 'R1939:Dync2h1'
ID213820
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Namedynein cytoplasmic 2 heavy chain 1
Synonyms4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
MMRRC Submission 039957-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1939 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location6928503-7184446 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 7139159 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193]
Predicted Effect probably null
Transcript: ENSMUST00000048417
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140466
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147056
Predicted Effect probably null
Transcript: ENSMUST00000147193
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,304 W11R probably damaging Het
2700049A03Rik A G 12: 71,160,412 probably null Het
3110002H16Rik T C 18: 12,180,505 L15P probably damaging Het
4933409G03Rik T C 2: 68,588,984 S26P possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acot3 A G 12: 84,058,551 N264S probably benign Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam22 A T 5: 8,330,015 F94L probably damaging Het
Adarb2 T C 13: 8,203,322 probably null Het
Aldh1b1 A G 4: 45,802,755 M98V possibly damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atp8b3 A T 10: 80,525,386 C785* probably null Het
Birc6 T C 17: 74,670,337 S4362P probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cntnap5b A G 1: 99,967,348 H115R probably benign Het
Col23a1 A G 11: 51,551,989 D159G unknown Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Dnase2a G T 8: 84,910,895 A309S possibly damaging Het
Engase T A 11: 118,479,186 N97K probably damaging Het
Fam83b A T 9: 76,493,080 M247K probably damaging Het
Fer T C 17: 63,973,128 S65P probably damaging Het
Fgf10 A G 13: 118,789,152 R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5415 T C 1: 32,545,546 I428V probably damaging Het
Gm904 T C 13: 50,644,736 probably null Het
Gpat2 T A 2: 127,435,959 *802K probably null Het
Hcfc2 G T 10: 82,702,450 R107L probably damaging Het
Itga8 T G 2: 12,300,846 D111A probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lgals8 T G 13: 12,459,188 I10L probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Mcpt1 A T 14: 56,019,089 K94I possibly damaging Het
Mpnd T C 17: 56,015,920 F384S probably damaging Het
Mrgprb5 A T 7: 48,168,938 N16K probably benign Het
Myo15b A G 11: 115,887,703 T1139A probably benign Het
Nat8f5 A C 6: 85,817,819 I53R possibly damaging Het
Nav1 A T 1: 135,465,898 L1034Q probably damaging Het
Nudt6 T C 3: 37,405,230 Y54C probably damaging Het
Olfr1404 G T 1: 173,215,932 A94S probably benign Het
Olfr482 A G 7: 108,095,141 V143A probably benign Het
Olfr815 A C 10: 129,902,101 M203R probably damaging Het
Olfr881 A G 9: 37,993,089 N199S probably benign Het
Olfr893 T A 9: 38,209,429 Y72* probably null Het
Osbpl8 A T 10: 111,289,811 H784L probably benign Het
Osr1 T G 12: 9,579,687 S187A probably damaging Het
Pcdhgc5 A G 18: 37,821,950 Y759C probably damaging Het
Pkd1l2 G T 8: 117,046,182 Y1035* probably null Het
Pla2g15 A G 8: 106,163,295 T400A probably damaging Het
Pms1 A C 1: 53,196,976 L715R probably damaging Het
Prkd1 T C 12: 50,394,994 N254S probably benign Het
Prkdc T C 16: 15,835,913 V3868A possibly damaging Het
Ptprt T C 2: 161,927,640 N435S probably benign Het
Purb T C 11: 6,474,943 E315G unknown Het
Rap1b A T 10: 117,818,586 N116K probably damaging Het
Rp1l1 A G 14: 64,029,593 N876S probably benign Het
Rps6ka4 T A 19: 6,839,466 I114F probably damaging Het
Sh3bp2 A G 5: 34,551,619 N19D probably damaging Het
Slc16a4 A G 3: 107,301,001 M276V probably benign Het
Slc17a1 A G 13: 23,875,881 T172A probably benign Het
Slc4a7 C T 14: 14,748,581 A320V probably damaging Het
Slco1a6 T A 6: 142,133,230 Y113F probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
St3gal6 A T 16: 58,473,561 probably null Het
Tdp2 A G 13: 24,841,277 D343G probably benign Het
Tecpr2 T A 12: 110,933,169 L657Q probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Trappc6a T A 7: 19,514,501 F28I probably damaging Het
Trim32 G A 4: 65,614,066 V287I probably benign Het
Trpd52l3 T C 19: 30,003,889 S15P probably damaging Het
Tsnaxip1 A G 8: 105,840,038 I169V probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttll11 T A 2: 35,940,753 Q18L probably null Het
Ttll8 A T 15: 88,915,486 I584N probably damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ucp3 T C 7: 100,480,664 V171A probably benign Het
Vmn1r174 T A 7: 23,754,107 I66N probably damaging Het
Vmn2r13 T C 5: 109,191,986 D41G possibly damaging Het
Vmn2r4 T C 3: 64,398,555 D393G probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp976 C A 7: 42,613,681 C244F unknown Het
Zmym5 A G 14: 56,799,120 V190A probably damaging Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0506:Dync2h1 UTSW 9 7113153 missense probably benign 0.05
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 intron probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7041734 splice site probably benign
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7049166 missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7001448 missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2012:Dync2h1 UTSW 9 7169589 missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7162802 missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R5982:Dync2h1 UTSW 9 6955986 missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7050479 missense probably benign
R7196:Dync2h1 UTSW 9 7147715 nonsense probably null
R7208:Dync2h1 UTSW 9 7141059 missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7142756 missense probably benign
R7237:Dync2h1 UTSW 9 6993966 missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7102405 missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6929590 missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7001454 missense possibly damaging 0.88
R7329:Dync2h1 UTSW 9 7011247 missense probably benign
R7351:Dync2h1 UTSW 9 7167145 missense probably damaging 1.00
R7358:Dync2h1 UTSW 9 7159479 critical splice donor site probably null
R7387:Dync2h1 UTSW 9 7157932 missense possibly damaging 0.68
R7446:Dync2h1 UTSW 9 7041720 missense probably benign 0.03
R7487:Dync2h1 UTSW 9 7132041 missense probably benign 0.26
R7488:Dync2h1 UTSW 9 7124855 missense probably benign 0.03
R7496:Dync2h1 UTSW 9 7135015 splice site probably null
R7501:Dync2h1 UTSW 9 7175336 missense possibly damaging 0.82
R7571:Dync2h1 UTSW 9 7002623 missense probably damaging 1.00
R7627:Dync2h1 UTSW 9 7101111 missense probably benign 0.00
R7639:Dync2h1 UTSW 9 7141254 missense probably damaging 0.97
R7653:Dync2h1 UTSW 9 7117570 missense probably benign
R7654:Dync2h1 UTSW 9 7122664 missense probably damaging 1.00
R7742:Dync2h1 UTSW 9 7076232 missense probably benign 0.00
R7755:Dync2h1 UTSW 9 7015490 missense probably benign 0.00
R7762:Dync2h1 UTSW 9 7129719 missense probably benign 0.01
R7790:Dync2h1 UTSW 9 7114914 missense probably damaging 0.96
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGCTGAGTCCTCTGAGAGACAC -3'
(R):5'- GCTTCAAAGATGCCAGAAATCC -3'

Sequencing Primer
(F):5'- GAGTCCTCTGAGAGACACCATTACTG -3'
(R):5'- CCCTAAATGAATTTTTGGAGGCATG -3'
Posted On2014-07-14