Incidental Mutation 'R1939:Fam83b'
ID 213823
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Name family with sequence similarity 83, member B
Synonyms C530008M07Rik
MMRRC Submission 039957-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R1939 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 76397336-76474398 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 76400362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 247 (M247K)
Ref Sequence ENSEMBL: ENSMUSP00000139354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
AlphaFold Q0VBM2
Predicted Effect probably damaging
Transcript: ENSMUST00000098546
AA Change: M247K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: M247K

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183437
AA Change: M247K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: M247K

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,331,130 (GRCm39) W11R probably damaging Het
2700049A03Rik A G 12: 71,207,186 (GRCm39) probably null Het
4933409G03Rik T C 2: 68,419,328 (GRCm39) S26P possibly damaging Het
Ace2 A T X: 162,939,524 (GRCm39) M123L possibly damaging Het
Acot3 A G 12: 84,105,325 (GRCm39) N264S probably benign Het
Acvr1c A T 2: 58,173,517 (GRCm39) N248K probably damaging Het
Adam22 A T 5: 8,380,015 (GRCm39) F94L probably damaging Het
Adarb2 T C 13: 8,253,358 (GRCm39) probably null Het
Aldh1b1 A G 4: 45,802,755 (GRCm39) M98V possibly damaging Het
Arfgef2 T A 2: 166,715,548 (GRCm39) V1331D probably damaging Het
Atf2 G A 2: 73,676,563 (GRCm39) P184S probably damaging Het
Atp8b3 A T 10: 80,361,220 (GRCm39) C785* probably null Het
Birc6 T C 17: 74,977,332 (GRCm39) S4362P probably damaging Het
Brd10 A G 19: 29,731,077 (GRCm39) F712S possibly damaging Het
Chn1 A G 2: 73,455,245 (GRCm39) C39R probably damaging Het
Cngb1 C A 8: 96,026,320 (GRCm39) G154W probably damaging Het
Cntnap5b A G 1: 99,895,073 (GRCm39) H115R probably benign Het
Col23a1 A G 11: 51,442,816 (GRCm39) D159G unknown Het
Coro7 T C 16: 4,446,596 (GRCm39) E843G probably benign Het
Dnase2a G T 8: 85,637,524 (GRCm39) A309S possibly damaging Het
Dync2h1 A G 9: 7,139,159 (GRCm39) probably null Het
Engase T A 11: 118,370,012 (GRCm39) N97K probably damaging Het
Fer T C 17: 64,280,123 (GRCm39) S65P probably damaging Het
Fgf10 A G 13: 118,925,688 (GRCm39) R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm904 T C 13: 50,798,772 (GRCm39) probably null Het
Gpat2 T A 2: 127,277,879 (GRCm39) *802K probably null Het
Hcfc2 G T 10: 82,538,284 (GRCm39) R107L probably damaging Het
Itga8 T G 2: 12,305,657 (GRCm39) D111A probably damaging Het
Jag1 C G 2: 136,925,393 (GRCm39) V1070L possibly damaging Het
Lama5 T C 2: 179,832,714 (GRCm39) N1646S probably benign Het
Lgals8 T G 13: 12,474,069 (GRCm39) I10L probably benign Het
Lrp1b A G 2: 40,587,601 (GRCm39) S116P unknown Het
Mcpt1 A T 14: 56,256,546 (GRCm39) K94I possibly damaging Het
Mpnd T C 17: 56,322,920 (GRCm39) F384S probably damaging Het
Mrgprb5 A T 7: 47,818,686 (GRCm39) N16K probably benign Het
Myo15b A G 11: 115,778,529 (GRCm39) T1139A probably benign Het
Nat8f5 A C 6: 85,794,801 (GRCm39) I53R possibly damaging Het
Nav1 A T 1: 135,393,636 (GRCm39) L1034Q probably damaging Het
Nudt6 T C 3: 37,459,379 (GRCm39) Y54C probably damaging Het
Or10j3b G T 1: 173,043,499 (GRCm39) A94S probably benign Het
Or5p58 A G 7: 107,694,348 (GRCm39) V143A probably benign Het
Or6c217 A C 10: 129,737,970 (GRCm39) M203R probably damaging Het
Or8b35 A G 9: 37,904,385 (GRCm39) N199S probably benign Het
Or8c15 T A 9: 38,120,725 (GRCm39) Y72* probably null Het
Osbpl8 A T 10: 111,125,672 (GRCm39) H784L probably benign Het
Osr1 T G 12: 9,629,687 (GRCm39) S187A probably damaging Het
Pcdhgc5 A G 18: 37,955,003 (GRCm39) Y759C probably damaging Het
Pkd1l2 G T 8: 117,772,921 (GRCm39) Y1035* probably null Het
Pla2g15 A G 8: 106,889,927 (GRCm39) T400A probably damaging Het
Pms1 A C 1: 53,236,135 (GRCm39) L715R probably damaging Het
Prkd1 T C 12: 50,441,777 (GRCm39) N254S probably benign Het
Prkdc T C 16: 15,653,777 (GRCm39) V3868A possibly damaging Het
Ptprt T C 2: 161,769,560 (GRCm39) N435S probably benign Het
Purb T C 11: 6,424,943 (GRCm39) E315G unknown Het
Rap1b A T 10: 117,654,491 (GRCm39) N116K probably damaging Het
Rmc1 T C 18: 12,313,562 (GRCm39) L15P probably damaging Het
Rp1l1 A G 14: 64,267,042 (GRCm39) N876S probably benign Het
Rps6ka4 T A 19: 6,816,834 (GRCm39) I114F probably damaging Het
Semp2l1 T C 1: 32,584,627 (GRCm39) I428V probably damaging Het
Sh3bp2 A G 5: 34,708,963 (GRCm39) N19D probably damaging Het
Slc16a4 A G 3: 107,208,317 (GRCm39) M276V probably benign Het
Slc17a1 A G 13: 24,059,864 (GRCm39) T172A probably benign Het
Slc4a7 C T 14: 14,748,581 (GRCm38) A320V probably damaging Het
Slco1a6 T A 6: 142,078,956 (GRCm39) Y113F probably damaging Het
Srsf6 C T 2: 162,776,403 (GRCm39) probably benign Het
St3gal6 A T 16: 58,293,924 (GRCm39) probably null Het
Tdp2 A G 13: 25,025,260 (GRCm39) D343G probably benign Het
Tecpr2 T A 12: 110,899,603 (GRCm39) L657Q probably damaging Het
Tet2 T C 3: 133,194,399 (GRCm39) T12A possibly damaging Het
Trappc6a T A 7: 19,248,426 (GRCm39) F28I probably damaging Het
Trim32 G A 4: 65,532,303 (GRCm39) V287I probably benign Het
Trpd52l3 T C 19: 29,981,289 (GRCm39) S15P probably damaging Het
Tsnaxip1 A G 8: 106,566,670 (GRCm39) I169V probably benign Het
Ttc34 G A 4: 154,950,139 (GRCm39) A1031T possibly damaging Het
Ttll11 T A 2: 35,830,765 (GRCm39) Q18L probably null Het
Ttll8 A T 15: 88,799,689 (GRCm39) I584N probably damaging Het
Ubiad1 A G 4: 148,528,468 (GRCm39) L147P probably damaging Het
Ucp3 T C 7: 100,129,871 (GRCm39) V171A probably benign Het
Vmn1r174 T A 7: 23,453,532 (GRCm39) I66N probably damaging Het
Vmn2r13 T C 5: 109,339,852 (GRCm39) D41G possibly damaging Het
Vmn2r4 T C 3: 64,305,976 (GRCm39) D393G probably benign Het
Wipf2 C T 11: 98,783,236 (GRCm39) R221* probably null Het
Zfp976 C A 7: 42,263,105 (GRCm39) C244F unknown Het
Zmym5 A G 14: 57,036,577 (GRCm39) V190A probably damaging Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76,398,260 (GRCm39) missense probably benign 0.00
IGL01554:Fam83b APN 9 76,409,403 (GRCm39) missense probably benign 0.33
IGL01694:Fam83b APN 9 76,398,272 (GRCm39) missense probably benign 0.13
IGL02009:Fam83b APN 9 76,399,604 (GRCm39) missense probably damaging 1.00
IGL02531:Fam83b APN 9 76,399,282 (GRCm39) missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76,400,324 (GRCm39) missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76,398,434 (GRCm39) missense probably damaging 1.00
R0110:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76,400,210 (GRCm39) nonsense probably null
R0946:Fam83b UTSW 9 76,398,679 (GRCm39) missense probably damaging 0.96
R0961:Fam83b UTSW 9 76,398,577 (GRCm39) missense probably damaging 0.97
R1101:Fam83b UTSW 9 76,452,952 (GRCm39) missense possibly damaging 0.68
R1200:Fam83b UTSW 9 76,399,594 (GRCm39) missense probably damaging 1.00
R1248:Fam83b UTSW 9 76,410,358 (GRCm39) missense probably benign 0.35
R1420:Fam83b UTSW 9 76,399,894 (GRCm39) missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76,399,859 (GRCm39) missense probably benign
R1992:Fam83b UTSW 9 76,399,304 (GRCm39) missense probably benign
R2102:Fam83b UTSW 9 76,399,987 (GRCm39) missense probably damaging 0.96
R2134:Fam83b UTSW 9 76,398,298 (GRCm39) missense probably damaging 1.00
R2398:Fam83b UTSW 9 76,409,500 (GRCm39) missense probably damaging 1.00
R2878:Fam83b UTSW 9 76,398,092 (GRCm39) missense probably damaging 1.00
R4092:Fam83b UTSW 9 76,398,943 (GRCm39) missense probably benign 0.24
R4204:Fam83b UTSW 9 76,410,335 (GRCm39) missense probably benign 0.09
R4537:Fam83b UTSW 9 76,399,424 (GRCm39) missense probably benign 0.10
R4920:Fam83b UTSW 9 76,399,150 (GRCm39) missense probably benign
R5456:Fam83b UTSW 9 76,399,877 (GRCm39) missense probably benign
R5473:Fam83b UTSW 9 76,398,782 (GRCm39) missense probably damaging 1.00
R5488:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5489:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5876:Fam83b UTSW 9 76,399,132 (GRCm39) missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76,399,639 (GRCm39) missense probably damaging 1.00
R6374:Fam83b UTSW 9 76,400,189 (GRCm39) missense probably benign 0.31
R6468:Fam83b UTSW 9 76,409,413 (GRCm39) nonsense probably null
R6912:Fam83b UTSW 9 76,398,214 (GRCm39) missense probably damaging 0.99
R7022:Fam83b UTSW 9 76,409,394 (GRCm39) frame shift probably null
R7073:Fam83b UTSW 9 76,453,031 (GRCm39) missense probably benign 0.18
R7356:Fam83b UTSW 9 76,400,135 (GRCm39) missense probably benign 0.05
R7665:Fam83b UTSW 9 76,398,157 (GRCm39) missense probably damaging 1.00
R7762:Fam83b UTSW 9 76,399,714 (GRCm39) missense possibly damaging 0.87
R7790:Fam83b UTSW 9 76,399,330 (GRCm39) missense probably benign 0.01
R7869:Fam83b UTSW 9 76,399,426 (GRCm39) missense possibly damaging 0.78
R7879:Fam83b UTSW 9 76,399,737 (GRCm39) missense possibly damaging 0.76
R7957:Fam83b UTSW 9 76,399,267 (GRCm39) missense probably benign 0.00
R8067:Fam83b UTSW 9 76,398,380 (GRCm39) missense probably benign
R8983:Fam83b UTSW 9 76,400,357 (GRCm39) missense probably damaging 1.00
R9361:Fam83b UTSW 9 76,400,076 (GRCm39) missense probably benign 0.03
R9405:Fam83b UTSW 9 76,398,703 (GRCm39) missense possibly damaging 0.93
R9475:Fam83b UTSW 9 76,399,085 (GRCm39) missense probably benign 0.31
R9656:Fam83b UTSW 9 76,452,863 (GRCm39) missense probably benign 0.02
R9690:Fam83b UTSW 9 76,398,502 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTCTCCCACAAGGCTTTGC -3'
(R):5'- ATTCACTTTAGCCCTGCTGG -3'

Sequencing Primer
(F):5'- GGCTTTGCCTGGCTTTGCC -3'
(R):5'- GAACTGGAAGTCAAATTGCTTTG -3'
Posted On 2014-07-14