Incidental Mutation 'R1939:Rp1l1'
ID213851
Institutional Source Beutler Lab
Gene Symbol Rp1l1
Ensembl Gene ENSMUSG00000046049
Gene Nameretinitis pigmentosa 1 homolog like 1
SynonymsDcdc4, Rp1hl1
MMRRC Submission 039957-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1939 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location63992506-64035025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64029593 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 876 (N876S)
Ref Sequence ENSEMBL: ENSMUSP00000055449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058229]
Predicted Effect probably benign
Transcript: ENSMUST00000058229
AA Change: N876S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: N876S

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
DCX 37 121 1.58e-13 SMART
DCX 155 239 1e-15 SMART
low complexity region 709 728 N/A INTRINSIC
low complexity region 870 884 N/A INTRINSIC
low complexity region 1159 1177 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1612 1618 N/A INTRINSIC
low complexity region 1642 1652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224314
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,304 W11R probably damaging Het
2700049A03Rik A G 12: 71,160,412 probably null Het
3110002H16Rik T C 18: 12,180,505 L15P probably damaging Het
4933409G03Rik T C 2: 68,588,984 S26P possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acot3 A G 12: 84,058,551 N264S probably benign Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam22 A T 5: 8,330,015 F94L probably damaging Het
Adarb2 T C 13: 8,203,322 probably null Het
Aldh1b1 A G 4: 45,802,755 M98V possibly damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atp8b3 A T 10: 80,525,386 C785* probably null Het
Birc6 T C 17: 74,670,337 S4362P probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cntnap5b A G 1: 99,967,348 H115R probably benign Het
Col23a1 A G 11: 51,551,989 D159G unknown Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Dnase2a G T 8: 84,910,895 A309S possibly damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Engase T A 11: 118,479,186 N97K probably damaging Het
Fam83b A T 9: 76,493,080 M247K probably damaging Het
Fer T C 17: 63,973,128 S65P probably damaging Het
Fgf10 A G 13: 118,789,152 R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5415 T C 1: 32,545,546 I428V probably damaging Het
Gm904 T C 13: 50,644,736 probably null Het
Gpat2 T A 2: 127,435,959 *802K probably null Het
Hcfc2 G T 10: 82,702,450 R107L probably damaging Het
Itga8 T G 2: 12,300,846 D111A probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lgals8 T G 13: 12,459,188 I10L probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Mcpt1 A T 14: 56,019,089 K94I possibly damaging Het
Mpnd T C 17: 56,015,920 F384S probably damaging Het
Mrgprb5 A T 7: 48,168,938 N16K probably benign Het
Myo15b A G 11: 115,887,703 T1139A probably benign Het
Nat8f5 A C 6: 85,817,819 I53R possibly damaging Het
Nav1 A T 1: 135,465,898 L1034Q probably damaging Het
Nudt6 T C 3: 37,405,230 Y54C probably damaging Het
Olfr1404 G T 1: 173,215,932 A94S probably benign Het
Olfr482 A G 7: 108,095,141 V143A probably benign Het
Olfr815 A C 10: 129,902,101 M203R probably damaging Het
Olfr881 A G 9: 37,993,089 N199S probably benign Het
Olfr893 T A 9: 38,209,429 Y72* probably null Het
Osbpl8 A T 10: 111,289,811 H784L probably benign Het
Osr1 T G 12: 9,579,687 S187A probably damaging Het
Pcdhgc5 A G 18: 37,821,950 Y759C probably damaging Het
Pkd1l2 G T 8: 117,046,182 Y1035* probably null Het
Pla2g15 A G 8: 106,163,295 T400A probably damaging Het
Pms1 A C 1: 53,196,976 L715R probably damaging Het
Prkd1 T C 12: 50,394,994 N254S probably benign Het
Prkdc T C 16: 15,835,913 V3868A possibly damaging Het
Ptprt T C 2: 161,927,640 N435S probably benign Het
Purb T C 11: 6,474,943 E315G unknown Het
Rap1b A T 10: 117,818,586 N116K probably damaging Het
Rps6ka4 T A 19: 6,839,466 I114F probably damaging Het
Sh3bp2 A G 5: 34,551,619 N19D probably damaging Het
Slc16a4 A G 3: 107,301,001 M276V probably benign Het
Slc17a1 A G 13: 23,875,881 T172A probably benign Het
Slc4a7 C T 14: 14,748,581 A320V probably damaging Het
Slco1a6 T A 6: 142,133,230 Y113F probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
St3gal6 A T 16: 58,473,561 probably null Het
Tdp2 A G 13: 24,841,277 D343G probably benign Het
Tecpr2 T A 12: 110,933,169 L657Q probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Trappc6a T A 7: 19,514,501 F28I probably damaging Het
Trim32 G A 4: 65,614,066 V287I probably benign Het
Trpd52l3 T C 19: 30,003,889 S15P probably damaging Het
Tsnaxip1 A G 8: 105,840,038 I169V probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttll11 T A 2: 35,940,753 Q18L probably null Het
Ttll8 A T 15: 88,915,486 I584N probably damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ucp3 T C 7: 100,480,664 V171A probably benign Het
Vmn1r174 T A 7: 23,754,107 I66N probably damaging Het
Vmn2r13 T C 5: 109,191,986 D41G possibly damaging Het
Vmn2r4 T C 3: 64,398,555 D393G probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp976 C A 7: 42,613,681 C244F unknown Het
Zmym5 A G 14: 56,799,120 V190A probably damaging Het
Other mutations in Rp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rp1l1 APN 14 64028725 missense probably benign 0.01
IGL02063:Rp1l1 APN 14 64029536 missense probably damaging 0.99
IGL02132:Rp1l1 APN 14 64028810 missense probably benign
IGL02430:Rp1l1 APN 14 64029286 missense probably benign 0.00
IGL02977:Rp1l1 APN 14 64028150 missense probably benign 0.01
IGL03213:Rp1l1 APN 14 64028415 missense probably damaging 0.98
IGL03346:Rp1l1 APN 14 64029440 missense probably benign
R0085:Rp1l1 UTSW 14 64022295 missense probably damaging 0.99
R0347:Rp1l1 UTSW 14 64030804 nonsense probably null
R0362:Rp1l1 UTSW 14 64031066 nonsense probably null
R0369:Rp1l1 UTSW 14 64029388 missense possibly damaging 0.84
R0538:Rp1l1 UTSW 14 64022092 missense probably damaging 1.00
R0544:Rp1l1 UTSW 14 64032066 missense probably benign 0.00
R0780:Rp1l1 UTSW 14 64030351 missense possibly damaging 0.94
R0944:Rp1l1 UTSW 14 64032232 missense probably benign 0.05
R1051:Rp1l1 UTSW 14 64032535 missense probably damaging 0.99
R1126:Rp1l1 UTSW 14 64030469 missense probably damaging 1.00
R1450:Rp1l1 UTSW 14 64028150 missense probably benign 0.01
R1483:Rp1l1 UTSW 14 64029047 missense possibly damaging 0.76
R1508:Rp1l1 UTSW 14 64030892 missense possibly damaging 0.83
R1553:Rp1l1 UTSW 14 64031894 missense probably benign 0.00
R1651:Rp1l1 UTSW 14 64030993 missense probably damaging 0.97
R1682:Rp1l1 UTSW 14 64028968 missense probably damaging 0.98
R1809:Rp1l1 UTSW 14 64027966 missense probably benign 0.18
R1885:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1887:Rp1l1 UTSW 14 64028390 missense probably benign 0.01
R1898:Rp1l1 UTSW 14 64031590 missense probably benign 0.04
R1924:Rp1l1 UTSW 14 64031543 missense probably benign
R1941:Rp1l1 UTSW 14 64022252 missense probably damaging 1.00
R2129:Rp1l1 UTSW 14 64028966 missense possibly damaging 0.93
R2363:Rp1l1 UTSW 14 64029998 missense possibly damaging 0.55
R3894:Rp1l1 UTSW 14 64029307 missense probably benign
R3974:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3975:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R3976:Rp1l1 UTSW 14 64030309 missense probably damaging 1.00
R4072:Rp1l1 UTSW 14 64028132 missense probably damaging 1.00
R4672:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4673:Rp1l1 UTSW 14 64031270 missense probably damaging 1.00
R4749:Rp1l1 UTSW 14 64029800 missense probably damaging 0.99
R4755:Rp1l1 UTSW 14 64030070 missense probably benign 0.34
R4877:Rp1l1 UTSW 14 64026171 missense probably benign 0.00
R4930:Rp1l1 UTSW 14 64032206 missense probably benign
R5039:Rp1l1 UTSW 14 64031356 missense probably benign 0.21
R5106:Rp1l1 UTSW 14 64027946 missense probably damaging 1.00
R5184:Rp1l1 UTSW 14 64030180 missense probably damaging 1.00
R5215:Rp1l1 UTSW 14 64030013 missense probably benign 0.01
R5409:Rp1l1 UTSW 14 64030621 missense probably benign 0.02
R5575:Rp1l1 UTSW 14 64030984 missense probably benign 0.23
R5696:Rp1l1 UTSW 14 64029746 missense probably damaging 0.99
R5739:Rp1l1 UTSW 14 64032170 missense probably benign 0.01
R5878:Rp1l1 UTSW 14 64028906 missense probably benign 0.09
R6133:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6134:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6135:Rp1l1 UTSW 14 64030096 missense probably damaging 1.00
R6428:Rp1l1 UTSW 14 64032389 missense possibly damaging 0.92
R6594:Rp1l1 UTSW 14 64031677 nonsense probably null
R6736:Rp1l1 UTSW 14 64029724 missense possibly damaging 0.93
R6800:Rp1l1 UTSW 14 64031150 missense possibly damaging 0.92
R6848:Rp1l1 UTSW 14 64028218 missense possibly damaging 0.79
R6878:Rp1l1 UTSW 14 64031852 missense probably benign 0.00
R6922:Rp1l1 UTSW 14 64030385 missense possibly damaging 0.93
R6980:Rp1l1 UTSW 14 64028720 missense probably benign 0.02
R7053:Rp1l1 UTSW 14 64031509 missense possibly damaging 0.68
R7151:Rp1l1 UTSW 14 64029026 missense possibly damaging 0.73
R7291:Rp1l1 UTSW 14 64032298 missense probably benign 0.10
R7335:Rp1l1 UTSW 14 64031998 missense probably benign 0.00
R7344:Rp1l1 UTSW 14 64029620 missense probably benign 0.00
R7470:Rp1l1 UTSW 14 64028566 missense probably benign
R7570:Rp1l1 UTSW 14 64031574 nonsense probably null
R7585:Rp1l1 UTSW 14 64030139 missense probably damaging 0.96
R7591:Rp1l1 UTSW 14 64026109 missense probably damaging 1.00
R7667:Rp1l1 UTSW 14 64029803 missense probably benign 0.04
X0057:Rp1l1 UTSW 14 64030040 missense probably benign 0.14
X0063:Rp1l1 UTSW 14 64029223 missense probably damaging 0.98
Z1088:Rp1l1 UTSW 14 64028758 missense possibly damaging 0.80
Z1088:Rp1l1 UTSW 14 64030378 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGGCAGATGATCCAAGAACC -3'
(R):5'- GTCTGCCATCTCATACGTCATG -3'

Sequencing Primer
(F):5'- GAACCTACCACGATTGCTGCTG -3'
(R):5'- TCATACGTCATGAGTACCGGC -3'
Posted On2014-07-14