Incidental Mutation 'R1939:Coro7'
ID213853
Institutional Source Beutler Lab
Gene Symbol Coro7
Ensembl Gene ENSMUSG00000039637
Gene Namecoronin 7
Synonyms0610011B16Rik
MMRRC Submission 039957-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1939 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location4626133-4679777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4628732 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 843 (E843G)
Ref Sequence ENSEMBL: ENSMUSP00000048489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014445] [ENSMUST00000038552] [ENSMUST00000135823] [ENSMUST00000156889]
Predicted Effect probably benign
Transcript: ENSMUST00000014445
SMART Domains Protein: ENSMUSP00000014445
Gene: ENSMUSG00000014301

DomainStartEndE-ValueType
Pfam:Pam16 1 125 4.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038552
AA Change: E843G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637
AA Change: E843G

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127125
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151156
Predicted Effect probably benign
Transcript: ENSMUST00000156889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229767
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal but exhibit disruption of the Golgi apparatus. Mutant fibroblasts show increased cell spreading and cellular F-actin content, increased cell polarization and migration, and enhanced wound healing in a scratch-wound assay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T A 11: 83,440,304 W11R probably damaging Het
2700049A03Rik A G 12: 71,160,412 probably null Het
3110002H16Rik T C 18: 12,180,505 L15P probably damaging Het
4933409G03Rik T C 2: 68,588,984 S26P possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acot3 A G 12: 84,058,551 N264S probably benign Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam22 A T 5: 8,330,015 F94L probably damaging Het
Adarb2 T C 13: 8,203,322 probably null Het
Aldh1b1 A G 4: 45,802,755 M98V possibly damaging Het
Arfgef2 T A 2: 166,873,628 V1331D probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atp8b3 A T 10: 80,525,386 C785* probably null Het
Birc6 T C 17: 74,670,337 S4362P probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cntnap5b A G 1: 99,967,348 H115R probably benign Het
Col23a1 A G 11: 51,551,989 D159G unknown Het
Dnase2a G T 8: 84,910,895 A309S possibly damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Engase T A 11: 118,479,186 N97K probably damaging Het
Fam83b A T 9: 76,493,080 M247K probably damaging Het
Fer T C 17: 63,973,128 S65P probably damaging Het
Fgf10 A G 13: 118,789,152 R156G probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5415 T C 1: 32,545,546 I428V probably damaging Het
Gm904 T C 13: 50,644,736 probably null Het
Gpat2 T A 2: 127,435,959 *802K probably null Het
Hcfc2 G T 10: 82,702,450 R107L probably damaging Het
Itga8 T G 2: 12,300,846 D111A probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lgals8 T G 13: 12,459,188 I10L probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Mcpt1 A T 14: 56,019,089 K94I possibly damaging Het
Mpnd T C 17: 56,015,920 F384S probably damaging Het
Mrgprb5 A T 7: 48,168,938 N16K probably benign Het
Myo15b A G 11: 115,887,703 T1139A probably benign Het
Nat8f5 A C 6: 85,817,819 I53R possibly damaging Het
Nav1 A T 1: 135,465,898 L1034Q probably damaging Het
Nudt6 T C 3: 37,405,230 Y54C probably damaging Het
Olfr1404 G T 1: 173,215,932 A94S probably benign Het
Olfr482 A G 7: 108,095,141 V143A probably benign Het
Olfr815 A C 10: 129,902,101 M203R probably damaging Het
Olfr881 A G 9: 37,993,089 N199S probably benign Het
Olfr893 T A 9: 38,209,429 Y72* probably null Het
Osbpl8 A T 10: 111,289,811 H784L probably benign Het
Osr1 T G 12: 9,579,687 S187A probably damaging Het
Pcdhgc5 A G 18: 37,821,950 Y759C probably damaging Het
Pkd1l2 G T 8: 117,046,182 Y1035* probably null Het
Pla2g15 A G 8: 106,163,295 T400A probably damaging Het
Pms1 A C 1: 53,196,976 L715R probably damaging Het
Prkd1 T C 12: 50,394,994 N254S probably benign Het
Prkdc T C 16: 15,835,913 V3868A possibly damaging Het
Ptprt T C 2: 161,927,640 N435S probably benign Het
Purb T C 11: 6,474,943 E315G unknown Het
Rap1b A T 10: 117,818,586 N116K probably damaging Het
Rp1l1 A G 14: 64,029,593 N876S probably benign Het
Rps6ka4 T A 19: 6,839,466 I114F probably damaging Het
Sh3bp2 A G 5: 34,551,619 N19D probably damaging Het
Slc16a4 A G 3: 107,301,001 M276V probably benign Het
Slc17a1 A G 13: 23,875,881 T172A probably benign Het
Slc4a7 C T 14: 14,748,581 A320V probably damaging Het
Slco1a6 T A 6: 142,133,230 Y113F probably damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
St3gal6 A T 16: 58,473,561 probably null Het
Tdp2 A G 13: 24,841,277 D343G probably benign Het
Tecpr2 T A 12: 110,933,169 L657Q probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Trappc6a T A 7: 19,514,501 F28I probably damaging Het
Trim32 G A 4: 65,614,066 V287I probably benign Het
Trpd52l3 T C 19: 30,003,889 S15P probably damaging Het
Tsnaxip1 A G 8: 105,840,038 I169V probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttll11 T A 2: 35,940,753 Q18L probably null Het
Ttll8 A T 15: 88,915,486 I584N probably damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ucp3 T C 7: 100,480,664 V171A probably benign Het
Vmn1r174 T A 7: 23,754,107 I66N probably damaging Het
Vmn2r13 T C 5: 109,191,986 D41G possibly damaging Het
Vmn2r4 T C 3: 64,398,555 D393G probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp976 C A 7: 42,613,681 C244F unknown Het
Zmym5 A G 14: 56,799,120 V190A probably damaging Het
Other mutations in Coro7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Coro7 APN 16 4634636 missense possibly damaging 0.83
IGL00885:Coro7 APN 16 4635026 missense probably benign 0.00
IGL02944:Coro7 APN 16 4635412 missense probably benign 0.14
IGL03104:Coro7 APN 16 4629126 missense probably damaging 1.00
IGL03153:Coro7 APN 16 4635382 critical splice donor site probably null
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0022:Coro7 UTSW 16 4633304 missense probably benign 0.01
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0071:Coro7 UTSW 16 4670527 missense probably damaging 1.00
R0080:Coro7 UTSW 16 4630464 missense probably damaging 1.00
R0193:Coro7 UTSW 16 4627504 unclassified probably benign
R0242:Coro7 UTSW 16 4630178 splice site probably benign
R0318:Coro7 UTSW 16 4675807 missense probably benign 0.09
R0554:Coro7 UTSW 16 4632257 missense possibly damaging 0.63
R0666:Coro7 UTSW 16 4631911 missense possibly damaging 0.70
R0835:Coro7 UTSW 16 4632254 missense probably benign 0.12
R0968:Coro7 UTSW 16 4670055 splice site probably benign
R1670:Coro7 UTSW 16 4628233 missense possibly damaging 0.76
R1709:Coro7 UTSW 16 4634441 splice site probably null
R1848:Coro7 UTSW 16 4630434 missense probably damaging 0.99
R1884:Coro7 UTSW 16 4628819 unclassified probably benign
R1935:Coro7 UTSW 16 4628732 missense probably benign
R1937:Coro7 UTSW 16 4628732 missense probably benign
R1967:Coro7 UTSW 16 4634889 missense probably damaging 1.00
R1969:Coro7 UTSW 16 4633756 missense probably benign 0.19
R1970:Coro7 UTSW 16 4633756 missense probably benign 0.19
R3034:Coro7 UTSW 16 4632291 missense probably damaging 0.99
R4638:Coro7 UTSW 16 4632287 missense probably damaging 0.96
R4710:Coro7 UTSW 16 4634933 intron probably benign
R4723:Coro7 UTSW 16 4631994 missense probably benign 0.00
R4789:Coro7 UTSW 16 4628221 missense probably damaging 1.00
R5493:Coro7 UTSW 16 4632487 missense probably damaging 0.99
R5619:Coro7 UTSW 16 4676935 critical splice donor site probably null
R5756:Coro7 UTSW 16 4632284 missense probably damaging 0.97
R5974:Coro7 UTSW 16 4631889 missense possibly damaging 0.83
R6010:Coro7 UTSW 16 4669956 missense possibly damaging 0.68
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6038:Coro7 UTSW 16 4679550 critical splice donor site probably null
R6906:Coro7 UTSW 16 4633304 missense probably benign 0.00
R6925:Coro7 UTSW 16 4628674 critical splice donor site probably null
R7069:Coro7 UTSW 16 4679611 start codon destroyed probably damaging 0.99
R7326:Coro7 UTSW 16 4632048 missense probably damaging 0.96
R7421:Coro7 UTSW 16 4668751 missense probably benign 0.19
R7521:Coro7 UTSW 16 4631482 missense probably benign 0.00
R7773:Coro7 UTSW 16 4632006 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACTTGCTCTCCAGGGGTTC -3'
(R):5'- GCATGTGAATGCCAGCATGG -3'

Sequencing Primer
(F):5'- GGTCTGGAGACATGTCTAACATCC -3'
(R):5'- ATGGGTGGGGCCAGGTC -3'
Posted On2014-07-14