Mutagenetix > Incidental Mutations

Incidental Mutation 'R1940:Mgat4a'

213869

Institutional Source

Beutler Lab

Gene Symbol

Mgat4a

Ensembl Gene

ENSMUSG00000026110

Gene Name

mannoside acetylglucosaminyltransferase 4, isoenzyme A

Synonyms

9530018I07Rik, GnT-IVa

MMRRC Submission

039958-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.252) question?

Stock #

R1940 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37439340-37541016 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 37536037 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042161] [ENSMUST00000151952] [ENSMUST00000154819]

Predicted Effect

probably null
Transcript: ENSMUST00000042161

SMART Domains

Protein: ENSMUSP00000038894
Gene: ENSMUSG00000026110

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
coiled coil region	28	63	N/A	INTRINSIC
Pfam:Glyco_transf_54	75	380	5.8e-137	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000151952

SMART Domains

Protein: ENSMUSP00000114175
Gene: ENSMUSG00000026110

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
coiled coil region	28	63	N/A	INTRINSIC
Pfam:Glyco_transf_54	86	380	7.5e-139	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000154819

SMART Domains

Protein: ENSMUSP00000121181
Gene: ENSMUSG00000026110

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
coiled coil region	28	63	N/A	INTRINSIC
Pfam:Glyco_transf_54	71	371	4.8e-137	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195598

Meta Mutation Damage Score

0.9578

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.8%
20x: 93.7%

Validation Efficiency

98% (108/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme B, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1,4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show defects in glucose-stimulated insulin secretion, impaired cellular glucose import, increased susceptibility to weight gain, hyperglycemia, impaired glucose tolerance, insulin resistance, high free fatty acid and triglyceride levels, and hepatic steatosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,233,852	S2496R	probably damaging	Het
Abca16	T	C	7: 120,433,609		probably benign	Het
Ace2	A	T	X: 164,156,528	M123L	possibly damaging	Het
Acvr1c	A	T	2: 58,283,505	N248K	probably damaging	Het
Adam24	A	T	8: 40,681,361	R623*	probably null	Het
Agbl2	T	A	2: 90,811,282	L752Q	probably damaging	Het
Ankrd26	A	T	6: 118,511,693	F1335Y	probably damaging	Het
Ankrd34a	A	G	3: 96,598,676	S399G	probably benign	Het
Ap3d1	G	A	10: 80,709,773	P1041S	probably benign	Het
Arid3b	A	T	9: 57,796,148	M466K	possibly damaging	Het
Arsj	T	C	3: 126,438,346	I247T	probably damaging	Het
AU016765	G	A	17: 64,519,878		noncoding transcript	Het
Azin2	C	T	4: 128,950,784		probably null	Het
Bcat2	T	C	7: 45,588,368	Y313H	possibly damaging	Het
Cables2	A	G	2: 180,260,080	V465A	probably damaging	Het
Ccdc60	G	A	5: 116,126,165	H517Y	probably damaging	Het
Cd55b	A	T	1: 130,418,106		probably null	Het
Cdc40	G	A	10: 40,883,071		probably benign	Het
Cdh7	G	A	1: 110,049,024	V140I	probably benign	Het
Cfi	T	C	3: 129,858,828		probably benign	Het
Chit1	G	A	1: 134,145,418		probably null	Het
Chn1	A	G	2: 73,624,901	C39R	probably damaging	Het
Ciao1	A	G	2: 127,246,460	S148P	possibly damaging	Het
Clmn	G	A	12: 104,790,102	T163I	probably damaging	Het
Cngb1	C	A	8: 95,299,692	G154W	probably damaging	Het
Col19a1	A	T	1: 24,264,750	C1117*	probably null	Het
Cyp2d10	T	A	15: 82,405,294	I206F	probably benign	Het
Ddrgk1	G	T	2: 130,663,560		probably benign	Het
Ddx18	A	T	1: 121,555,224	V611D	probably damaging	Het
Dnah8	A	T	17: 30,731,207	H2000L	probably damaging	Het
Duox1	T	C	2: 122,325,984	V464A	probably benign	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Eif4enif1	A	G	11: 3,243,279	H857R	probably damaging	Het
Elmo2	A	G	2: 165,292,050		probably benign	Het
Fam171b	CCAGCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGCAGC	2: 83,812,874		probably benign	Het
Glrx	A	G	13: 75,840,137	I57V	probably benign	Het
Gm281	A	T	14: 13,828,582	M726K	probably null	Het
Golm1	A	T	13: 59,642,237		probably benign	Het
Grm3	G	A	5: 9,511,682	R723W	probably damaging	Het
Gsta3	G	A	1: 21,257,377	R45Q	probably benign	Het
Gtf3c3	A	C	1: 54,428,958		probably benign	Het
Hk3	C	T	13: 55,011,391	V451I	probably damaging	Het
Hoxa10	C	A	6: 52,234,370	G189C	possibly damaging	Het
Hs3st3b1	T	C	11: 63,889,743	D186G	probably benign	Het
Hscb	G	T	5: 110,836,060	H63N	probably benign	Het
Itpr3	A	G	17: 27,111,217	E1603G	probably damaging	Het
Ivl	T	A	3: 92,572,749	H3L	probably benign	Het
Klhl26	C	A	8: 70,452,261	R252L	probably damaging	Het
Krt31	T	A	11: 100,048,243	T251S	probably benign	Het
Lama5	T	C	2: 180,190,921	N1646S	probably benign	Het
Lhx3	T	C	2: 26,203,962	D83G	probably benign	Het
Lss	C	A	10: 76,545,462	N427K	possibly damaging	Het
Mettl24	G	A	10: 40,737,726	A154T	probably benign	Het
Moxd2	C	T	6: 40,883,532	R326Q	probably damaging	Het
Mpdz	G	A	4: 81,361,443	A669V	probably benign	Het
Msra	G	A	14: 64,285,056		probably benign	Het
Muc13	A	T	16: 33,807,911	T344S	probably benign	Het
Myo3b	T	C	2: 70,258,075	I866T	probably benign	Het
Nbea	T	C	3: 55,953,100	S1852G	possibly damaging	Het
Ncf2	A	G	1: 152,834,064		probably benign	Het
Nfyc	C	A	4: 120,773,664		probably benign	Het
Nop2	T	C	6: 125,134,634	V110A	probably benign	Het
Nrg2	C	A	18: 36,196,844		probably benign	Het
Nrl	A	G	14: 55,522,435	Y12H	probably damaging	Het
Nrxn3	T	C	12: 89,260,381	V635A	probably damaging	Het
Olfr1014	T	A	2: 85,777,171	S196T	probably benign	Het
Olfr1415	T	A	1: 92,491,735	T7S	probably benign	Het
Olfr1423	A	C	19: 12,035,911	V277G	probably benign	Het
Olfr228	T	A	2: 86,483,359	K128*	probably null	Het
Papolg	A	T	11: 23,867,279	N639K	probably benign	Het
Paqr4	T	C	17: 23,737,664	I242V	probably damaging	Het
Pramel6	A	T	2: 87,508,732	K92M	probably damaging	Het
Prg4	T	C	1: 150,456,023	T300A	possibly damaging	Het
Ptprb	A	T	10: 116,319,610		probably benign	Het
Rab28	A	T	5: 41,625,790	S216T	probably benign	Het
Rrp1b	A	T	17: 32,056,845	R455S	possibly damaging	Het
Sash1	A	T	10: 8,729,932	M898K	probably benign	Het
Scn8a	C	T	15: 100,970,204	T310I	probably benign	Het
Secisbp2l	C	A	2: 125,740,339	D1066Y	probably damaging	Het
Sipa1l2	A	G	8: 125,480,148		probably benign	Het
Slc12a1	A	G	2: 125,194,193	T662A	probably benign	Het
Slc12a4	T	C	8: 105,946,037	I749V	probably benign	Het
Slc22a27	A	G	19: 7,909,727	S266P	probably damaging	Het
Slc25a14	G	A	X: 48,651,963	V210I	probably benign	Het
Slit1	T	A	19: 41,630,776	N762I	probably damaging	Het
Spata31d1b	C	A	13: 59,718,021	D994E	possibly damaging	Het
Sphk1	A	G	11: 116,535,850	I204V	probably benign	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
Svs1	A	T	6: 48,990,073	K652*	probably null	Het
Tet2	T	C	3: 133,488,638	T12A	possibly damaging	Het
Tgfbi	A	T	13: 56,614,314	Q70L	possibly damaging	Het
Tlr9	T	C	9: 106,224,647	L379P	probably damaging	Het
Tnrc6c	A	G	11: 117,756,023	D1450G	possibly damaging	Het
Tra2b	A	G	16: 22,255,045		probably benign	Het
Trit1	T	C	4: 123,054,240	I451T	probably benign	Het
Trnau1ap	A	G	4: 132,321,803	Y30H	probably damaging	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Ush2a	A	G	1: 188,951,561	D4979G	probably null	Het
Usp50	C	T	2: 126,778,023	R123Q	probably benign	Het
Vmn2r117	A	T	17: 23,477,480	Y318N	probably damaging	Het
Whamm	C	T	7: 81,578,299	T304I	probably null	Het
Wipf2	C	T	11: 98,892,410	R221*	probably null	Het
Ythdf3	A	G	3: 16,205,092	N468D	possibly damaging	Het
Zbtb17	T	C	4: 141,465,548	I486T	possibly damaging	Het
Zfp3	T	C	11: 70,771,376	S54P	probably benign	Het
Zscan10	A	T	17: 23,609,852	H379L	probably damaging	Het

Other mutations in Mgat4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Mgat4a	APN	1	37449123	nonsense	probably null
IGL01720:Mgat4a	APN	1	37444898	missense	probably damaging	1.00
IGL02103:Mgat4a	APN	1	37462926	missense	possibly damaging	0.94
IGL03177:Mgat4a	APN	1	37444887	missense	probably damaging	1.00
R0090:Mgat4a	UTSW	1	37490333	missense	probably damaging	1.00
R0269:Mgat4a	UTSW	1	37490307	missense	possibly damaging	0.89
R0635:Mgat4a	UTSW	1	37452294	missense	probably benign	0.11
R1114:Mgat4a	UTSW	1	37464406	splice site	probably benign
R1120:Mgat4a	UTSW	1	37452581	missense	probably damaging	1.00
R1466:Mgat4a	UTSW	1	37464406	splice site	probably benign
R2257:Mgat4a	UTSW	1	37490313	missense	probably benign	0.13
R2293:Mgat4a	UTSW	1	37452592	missense	probably damaging	0.99
R2370:Mgat4a	UTSW	1	37464533	missense	probably damaging	0.96
R2392:Mgat4a	UTSW	1	37498704	missense	probably damaging	1.00
R3952:Mgat4a	UTSW	1	37450414	splice site	probably benign
R4563:Mgat4a	UTSW	1	37466579	missense	probably damaging	1.00
R5424:Mgat4a	UTSW	1	37466555	missense	probably benign	0.01
R5494:Mgat4a	UTSW	1	37454817	missense	probably damaging	1.00
R5505:Mgat4a	UTSW	1	37495954	missense	probably benign	0.04
R5938:Mgat4a	UTSW	1	37452263	missense	probably damaging	0.99
R6237:Mgat4a	UTSW	1	37456592	missense	probably damaging	1.00
R6589:Mgat4a	UTSW	1	37444895	missense	probably damaging	0.99
R6817:Mgat4a	UTSW	1	37449123	nonsense	probably null
R6825:Mgat4a	UTSW	1	37464434	nonsense	probably null
R7402:Mgat4a	UTSW	1	37454784	missense	probably damaging	1.00
R7507:Mgat4a	UTSW	1	37452527	missense	probably damaging	1.00
R7789:Mgat4a	UTSW	1	37490279	missense	probably damaging	0.97
X0063:Mgat4a	UTSW	1	37462890	critical splice donor site	probably null
Z1177:Mgat4a	UTSW	1	37490372	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTTTCCAAAGTGTGATCATAAG -3'
(R):5'- GACCAAGGCGTTCTGGATTC -3'

Sequencing Primer
(F):5'- CAGGAGTCAGAAGTCTGTATCAGTC -3'
(R):5'- CCAAGGCGTTCTGGATTCTGTTG -3'

Posted On

2014-07-14