Incidental Mutation 'R1940:Prg4'
ID213877
Institutional Source Beutler Lab
Gene Symbol Prg4
Ensembl Gene ENSMUSG00000006014
Gene Nameproteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
SynonymsDOL54, SZP, lubricin, MSF
MMRRC Submission 039958-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1940 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location150449412-150466165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150456023 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 300 (T300A)
Ref Sequence ENSEMBL: ENSMUSP00000128943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006171] [ENSMUST00000111901] [ENSMUST00000111902] [ENSMUST00000159035] [ENSMUST00000161320] [ENSMUST00000161611] [ENSMUST00000162367] [ENSMUST00000164600]
Predicted Effect probably benign
Transcript: ENSMUST00000006171
SMART Domains Protein: ENSMUSP00000006171
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111901
AA Change: T212A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107532
Gene: ENSMUSG00000006014
AA Change: T212A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 141 151 N/A INTRINSIC
low complexity region 189 221 N/A INTRINSIC
low complexity region 241 535 N/A INTRINSIC
low complexity region 570 623 N/A INTRINSIC
HX 711 753 1.67e-7 SMART
HX 755 798 3.76e-10 SMART
Blast:HX 911 964 5e-27 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111902
AA Change: T259A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107533
Gene: ENSMUSG00000006014
AA Change: T259A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 86 143 N/A INTRINSIC
low complexity region 150 171 N/A INTRINSIC
low complexity region 188 198 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
low complexity region 288 582 N/A INTRINSIC
internal_repeat_1 588 614 2.72e-5 PROSPERO
low complexity region 617 670 N/A INTRINSIC
internal_repeat_1 680 706 2.72e-5 PROSPERO
HX 758 800 1.67e-7 SMART
HX 802 845 3.76e-10 SMART
Blast:HX 958 1011 4e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159035
SMART Domains Protein: ENSMUSP00000124410
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161320
AA Change: T171A
SMART Domains Protein: ENSMUSP00000124801
Gene: ENSMUSG00000006014
AA Change: T171A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 3.83e-15 SMART
low complexity region 69 83 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
low complexity region 148 179 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161611
AA Change: T300A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125677
Gene: ENSMUSG00000006014
AA Change: T300A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 578 691 2.2e-9 PFAM
internal_repeat_3 796 825 7.42e-5 PROSPERO
internal_repeat_2 797 823 1.24e-5 PROSPERO
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162367
SMART Domains Protein: ENSMUSP00000125551
Gene: ENSMUSG00000006014

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000164600
AA Change: T300A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128943
Gene: ENSMUSG00000006014
AA Change: T300A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 404 497 2.4e-14 PFAM
Pfam:Cornifin 468 584 3.2e-15 PFAM
Pfam:Cornifin 550 648 3.3e-16 PFAM
Pfam:Cornifin 625 722 2.1e-15 PFAM
Pfam:Cornifin 647 743 7.8e-16 PFAM
Pfam:Cornifin 706 822 1.4e-12 PFAM
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency 98% (108/110)
MGI Phenotype PHENOTYPE: Aging homozygous null mice develop a hopping gait, irregular endochondral growth plates, altered cartilage surface, camptodactyly, progressive synovial hyperplasia and, ultimately, joint failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,233,852 S2496R probably damaging Het
Abca16 T C 7: 120,433,609 probably benign Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam24 A T 8: 40,681,361 R623* probably null Het
Agbl2 T A 2: 90,811,282 L752Q probably damaging Het
Ankrd26 A T 6: 118,511,693 F1335Y probably damaging Het
Ankrd34a A G 3: 96,598,676 S399G probably benign Het
Ap3d1 G A 10: 80,709,773 P1041S probably benign Het
Arid3b A T 9: 57,796,148 M466K possibly damaging Het
Arsj T C 3: 126,438,346 I247T probably damaging Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Azin2 C T 4: 128,950,784 probably null Het
Bcat2 T C 7: 45,588,368 Y313H possibly damaging Het
Cables2 A G 2: 180,260,080 V465A probably damaging Het
Ccdc60 G A 5: 116,126,165 H517Y probably damaging Het
Cd55b A T 1: 130,418,106 probably null Het
Cdc40 G A 10: 40,883,071 probably benign Het
Cdh7 G A 1: 110,049,024 V140I probably benign Het
Cfi T C 3: 129,858,828 probably benign Het
Chit1 G A 1: 134,145,418 probably null Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clmn G A 12: 104,790,102 T163I probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Col19a1 A T 1: 24,264,750 C1117* probably null Het
Cyp2d10 T A 15: 82,405,294 I206F probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Ddx18 A T 1: 121,555,224 V611D probably damaging Het
Dnah8 A T 17: 30,731,207 H2000L probably damaging Het
Duox1 T C 2: 122,325,984 V464A probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eif4enif1 A G 11: 3,243,279 H857R probably damaging Het
Elmo2 A G 2: 165,292,050 probably benign Het
Fam171b CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC 2: 83,812,874 probably benign Het
Glrx A G 13: 75,840,137 I57V probably benign Het
Gm281 A T 14: 13,828,582 M726K probably null Het
Golm1 A T 13: 59,642,237 probably benign Het
Grm3 G A 5: 9,511,682 R723W probably damaging Het
Gsta3 G A 1: 21,257,377 R45Q probably benign Het
Gtf3c3 A C 1: 54,428,958 probably benign Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Hs3st3b1 T C 11: 63,889,743 D186G probably benign Het
Hscb G T 5: 110,836,060 H63N probably benign Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Ivl T A 3: 92,572,749 H3L probably benign Het
Klhl26 C A 8: 70,452,261 R252L probably damaging Het
Krt31 T A 11: 100,048,243 T251S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lhx3 T C 2: 26,203,962 D83G probably benign Het
Lss C A 10: 76,545,462 N427K possibly damaging Het
Mettl24 G A 10: 40,737,726 A154T probably benign Het
Mgat4a A T 1: 37,536,037 probably null Het
Moxd2 C T 6: 40,883,532 R326Q probably damaging Het
Mpdz G A 4: 81,361,443 A669V probably benign Het
Msra G A 14: 64,285,056 probably benign Het
Muc13 A T 16: 33,807,911 T344S probably benign Het
Myo3b T C 2: 70,258,075 I866T probably benign Het
Nbea T C 3: 55,953,100 S1852G possibly damaging Het
Ncf2 A G 1: 152,834,064 probably benign Het
Nfyc C A 4: 120,773,664 probably benign Het
Nop2 T C 6: 125,134,634 V110A probably benign Het
Nrg2 C A 18: 36,196,844 probably benign Het
Nrl A G 14: 55,522,435 Y12H probably damaging Het
Nrxn3 T C 12: 89,260,381 V635A probably damaging Het
Olfr1014 T A 2: 85,777,171 S196T probably benign Het
Olfr1415 T A 1: 92,491,735 T7S probably benign Het
Olfr1423 A C 19: 12,035,911 V277G probably benign Het
Olfr228 T A 2: 86,483,359 K128* probably null Het
Papolg A T 11: 23,867,279 N639K probably benign Het
Paqr4 T C 17: 23,737,664 I242V probably damaging Het
Pramel6 A T 2: 87,508,732 K92M probably damaging Het
Ptprb A T 10: 116,319,610 probably benign Het
Rab28 A T 5: 41,625,790 S216T probably benign Het
Rrp1b A T 17: 32,056,845 R455S possibly damaging Het
Sash1 A T 10: 8,729,932 M898K probably benign Het
Scn8a C T 15: 100,970,204 T310I probably benign Het
Secisbp2l C A 2: 125,740,339 D1066Y probably damaging Het
Sipa1l2 A G 8: 125,480,148 probably benign Het
Slc12a1 A G 2: 125,194,193 T662A probably benign Het
Slc12a4 T C 8: 105,946,037 I749V probably benign Het
Slc22a27 A G 19: 7,909,727 S266P probably damaging Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slit1 T A 19: 41,630,776 N762I probably damaging Het
Spata31d1b C A 13: 59,718,021 D994E possibly damaging Het
Sphk1 A G 11: 116,535,850 I204V probably benign Het
Srsf6 C T 2: 162,934,483 probably benign Het
Svs1 A T 6: 48,990,073 K652* probably null Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tgfbi A T 13: 56,614,314 Q70L possibly damaging Het
Tlr9 T C 9: 106,224,647 L379P probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Tra2b A G 16: 22,255,045 probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trnau1ap A G 4: 132,321,803 Y30H probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ush2a A G 1: 188,951,561 D4979G probably null Het
Usp50 C T 2: 126,778,023 R123Q probably benign Het
Vmn2r117 A T 17: 23,477,480 Y318N probably damaging Het
Whamm C T 7: 81,578,299 T304I probably null Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Ythdf3 A G 3: 16,205,092 N468D possibly damaging Het
Zbtb17 T C 4: 141,465,548 I486T possibly damaging Het
Zfp3 T C 11: 70,771,376 S54P probably benign Het
Zscan10 A T 17: 23,609,852 H379L probably damaging Het
Other mutations in Prg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Prg4 APN 1 150451920 missense probably damaging 0.99
IGL02033:Prg4 APN 1 150455868 intron probably benign
IGL02154:Prg4 APN 1 150454862 intron probably benign
IGL03111:Prg4 APN 1 150451902 missense probably benign 0.06
IGL03177:Prg4 APN 1 150455603 intron probably benign
IGL03260:Prg4 APN 1 150455627 intron probably benign
IGL03281:Prg4 APN 1 150450088 splice site probably benign
R0046:Prg4 UTSW 1 150456086 missense possibly damaging 0.53
R0046:Prg4 UTSW 1 150456086 missense possibly damaging 0.53
R0196:Prg4 UTSW 1 150454492 intron probably benign
R0233:Prg4 UTSW 1 150453547 splice site probably benign
R0255:Prg4 UTSW 1 150455807 intron probably benign
R0616:Prg4 UTSW 1 150460711 missense probably damaging 1.00
R1016:Prg4 UTSW 1 150454691 intron probably benign
R1826:Prg4 UTSW 1 150452009 missense probably benign 0.09
R1862:Prg4 UTSW 1 150460669 missense probably damaging 0.99
R1863:Prg4 UTSW 1 150460669 missense probably damaging 0.99
R1922:Prg4 UTSW 1 150449999 nonsense probably null
R3765:Prg4 UTSW 1 150451371 missense probably damaging 0.97
R3855:Prg4 UTSW 1 150452000 missense probably damaging 1.00
R3894:Prg4 UTSW 1 150454759 intron probably benign
R3895:Prg4 UTSW 1 150454759 intron probably benign
R3912:Prg4 UTSW 1 150451868 missense probably damaging 1.00
R3935:Prg4 UTSW 1 150458157 missense possibly damaging 0.68
R4050:Prg4 UTSW 1 150454759 intron probably benign
R4475:Prg4 UTSW 1 150454859 intron probably benign
R4794:Prg4 UTSW 1 150454546 intron probably benign
R4910:Prg4 UTSW 1 150455823 intron probably benign
R4911:Prg4 UTSW 1 150455823 intron probably benign
R4993:Prg4 UTSW 1 150460681 missense probably damaging 1.00
R5378:Prg4 UTSW 1 150455226 intron probably benign
R5381:Prg4 UTSW 1 150454453 intron probably benign
R5452:Prg4 UTSW 1 150455768 intron probably benign
R5870:Prg4 UTSW 1 150455549 nonsense probably null
R5888:Prg4 UTSW 1 150452350 missense probably damaging 1.00
R5929:Prg4 UTSW 1 150454129 missense probably benign 0.01
R6058:Prg4 UTSW 1 150451446 missense probably damaging 0.99
R6059:Prg4 UTSW 1 150449997 missense possibly damaging 0.67
R6232:Prg4 UTSW 1 150455816 intron probably benign
R6272:Prg4 UTSW 1 150454766 intron probably benign
R6459:Prg4 UTSW 1 150454301 intron probably benign
R6659:Prg4 UTSW 1 150460681 missense probably damaging 1.00
R6663:Prg4 UTSW 1 150455101 intron probably benign
R6882:Prg4 UTSW 1 150453495 missense probably damaging 1.00
R6970:Prg4 UTSW 1 150455906 intron probably benign
R7078:Prg4 UTSW 1 150458263 missense possibly damaging 0.91
R7102:Prg4 UTSW 1 150452254 missense probably damaging 1.00
R7264:Prg4 UTSW 1 150454067 missense not run
R7487:Prg4 UTSW 1 150455905 missense unknown
R7531:Prg4 UTSW 1 150455035 missense unknown
R7651:Prg4 UTSW 1 150454945 missense unknown
R7701:Prg4 UTSW 1 150457542 missense possibly damaging 0.53
X0024:Prg4 UTSW 1 150454492 intron probably benign
Predicted Primers PCR Primer
(F):5'- GAGTTGTGGGTTCAGGCTCC -3'
(R):5'- TGAGTTCAAGCTCACCCCAC -3'

Sequencing Primer
(F):5'- CAGGCTCCTTGGGGGTG -3'
(R):5'- TGACCCTCCTACTACTCCACACAG -3'
Posted On2014-07-14