Mutagenetix > Incidental Mutation

Incidental Mutation 'R1940:Slc12a4'

213932

Institutional Source

Beutler Lab

Gene Symbol

Slc12a4

Ensembl Gene

ENSMUSG00000017765

Gene Name

solute carrier family 12, member 4

Synonyms

KCC1, K-Cl Co-transporter-1

MMRRC Submission

039958-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.228) question?

Stock #

R1940 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105943590-105966097 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 105946037 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 749 (I749V)

Ref Sequence

ENSEMBL: ENSMUSP00000112130 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034370] [ENSMUST00000038896] [ENSMUST00000116429]

AlphaFold

Q9JIS8

Predicted Effect

probably benign
Transcript: ENSMUST00000034370
AA Change: I751V

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765
AA Change: I751V

Domain	Start	End	E-Value	Type
low complexity region	97	117	N/A	INTRINSIC
Pfam:AA_permease	125	318	5.8e-28	PFAM
Pfam:AA_permease	409	698	1.2e-40	PFAM
Pfam:SLC12	710	833	7.1e-18	PFAM
Pfam:SLC12	829	1087	4.8e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000038896

SMART Domains

Protein: ENSMUSP00000038232
Gene: ENSMUSG00000035237

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:LCAT	81	414	1.7e-111	PFAM
low complexity region	425	437	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000116429
AA Change: I749V

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765
AA Change: I749V

Domain	Start	End	E-Value	Type
low complexity region	95	115	N/A	INTRINSIC
Pfam:AA_permease	123	309	7.7e-29	PFAM
Pfam:AA_permease_2	390	654	2.9e-17	PFAM
Pfam:AA_permease	404	696	4.4e-39	PFAM
Pfam:KCl_Cotrans_1	953	982	9.2e-21	PFAM
low complexity region	1065	1080	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141168

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141326

Meta Mutation Damage Score

0.1039

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.8%
20x: 93.7%

Validation Efficiency

98% (108/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC12A transporter family. The encoded protein mediates the coupled movement of potassium and chloride ions across the plasma membrane. This gene is expressed ubiquitously. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a constitutively active mutation display microcytosis and hypochromic anemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,233,852	S2496R	probably damaging	Het
Abca16	T	C	7: 120,433,609		probably benign	Het
Ace2	A	T	X: 164,156,528	M123L	possibly damaging	Het
Acvr1c	A	T	2: 58,283,505	N248K	probably damaging	Het
Adam24	A	T	8: 40,681,361	R623*	probably null	Het
Agbl2	T	A	2: 90,811,282	L752Q	probably damaging	Het
Ankrd26	A	T	6: 118,511,693	F1335Y	probably damaging	Het
Ankrd34a	A	G	3: 96,598,676	S399G	probably benign	Het
Ap3d1	G	A	10: 80,709,773	P1041S	probably benign	Het
Arid3b	A	T	9: 57,796,148	M466K	possibly damaging	Het
Arsj	T	C	3: 126,438,346	I247T	probably damaging	Het
AU016765	G	A	17: 64,519,878		noncoding transcript	Het
Azin2	C	T	4: 128,950,784		probably null	Het
Bcat2	T	C	7: 45,588,368	Y313H	possibly damaging	Het
Cables2	A	G	2: 180,260,080	V465A	probably damaging	Het
Ccdc60	G	A	5: 116,126,165	H517Y	probably damaging	Het
Cd55b	A	T	1: 130,418,106		probably null	Het
Cdc40	G	A	10: 40,883,071		probably benign	Het
Cdh7	G	A	1: 110,049,024	V140I	probably benign	Het
Cfi	T	C	3: 129,858,828		probably benign	Het
Chit1	G	A	1: 134,145,418		probably null	Het
Chn1	A	G	2: 73,624,901	C39R	probably damaging	Het
Ciao1	A	G	2: 127,246,460	S148P	possibly damaging	Het
Clmn	G	A	12: 104,790,102	T163I	probably damaging	Het
Cngb1	C	A	8: 95,299,692	G154W	probably damaging	Het
Col19a1	A	T	1: 24,264,750	C1117*	probably null	Het
Cyp2d10	T	A	15: 82,405,294	I206F	probably benign	Het
Ddrgk1	G	T	2: 130,663,560		probably benign	Het
Ddx18	A	T	1: 121,555,224	V611D	probably damaging	Het
Dnah8	A	T	17: 30,731,207	H2000L	probably damaging	Het
Duox1	T	C	2: 122,325,984	V464A	probably benign	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Eif4enif1	A	G	11: 3,243,279	H857R	probably damaging	Het
Elmo2	A	G	2: 165,292,050		probably benign	Het
Fam171b	CCAGCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGCAGC	2: 83,812,874		probably benign	Het
Glrx	A	G	13: 75,840,137	I57V	probably benign	Het
Gm281	A	T	14: 13,828,582	M726K	probably null	Het
Golm1	A	T	13: 59,642,237		probably benign	Het
Grm3	G	A	5: 9,511,682	R723W	probably damaging	Het
Gsta3	G	A	1: 21,257,377	R45Q	probably benign	Het
Gtf3c3	A	C	1: 54,428,958		probably benign	Het
Hk3	C	T	13: 55,011,391	V451I	probably damaging	Het
Hoxa10	C	A	6: 52,234,370	G189C	possibly damaging	Het
Hs3st3b1	T	C	11: 63,889,743	D186G	probably benign	Het
Hscb	G	T	5: 110,836,060	H63N	probably benign	Het
Itpr3	A	G	17: 27,111,217	E1603G	probably damaging	Het
Ivl	T	A	3: 92,572,749	H3L	probably benign	Het
Klhl26	C	A	8: 70,452,261	R252L	probably damaging	Het
Krt31	T	A	11: 100,048,243	T251S	probably benign	Het
Lama5	T	C	2: 180,190,921	N1646S	probably benign	Het
Lhx3	T	C	2: 26,203,962	D83G	probably benign	Het
Lss	C	A	10: 76,545,462	N427K	possibly damaging	Het
Mettl24	G	A	10: 40,737,726	A154T	probably benign	Het
Mgat4a	A	T	1: 37,536,037		probably null	Het
Moxd2	C	T	6: 40,883,532	R326Q	probably damaging	Het
Mpdz	G	A	4: 81,361,443	A669V	probably benign	Het
Msra	G	A	14: 64,285,056		probably benign	Het
Muc13	A	T	16: 33,807,911	T344S	probably benign	Het
Myo3b	T	C	2: 70,258,075	I866T	probably benign	Het
Nbea	T	C	3: 55,953,100	S1852G	possibly damaging	Het
Ncf2	A	G	1: 152,834,064		probably benign	Het
Nfyc	C	A	4: 120,773,664		probably benign	Het
Nop2	T	C	6: 125,134,634	V110A	probably benign	Het
Nrg2	C	A	18: 36,196,844		probably benign	Het
Nrl	A	G	14: 55,522,435	Y12H	probably damaging	Het
Nrxn3	T	C	12: 89,260,381	V635A	probably damaging	Het
Olfr1014	T	A	2: 85,777,171	S196T	probably benign	Het
Olfr1415	T	A	1: 92,491,735	T7S	probably benign	Het
Olfr1423	A	C	19: 12,035,911	V277G	probably benign	Het
Olfr228	T	A	2: 86,483,359	K128*	probably null	Het
Papolg	A	T	11: 23,867,279	N639K	probably benign	Het
Paqr4	T	C	17: 23,737,664	I242V	probably damaging	Het
Pramel6	A	T	2: 87,508,732	K92M	probably damaging	Het
Prg4	T	C	1: 150,456,023	T300A	possibly damaging	Het
Ptprb	A	T	10: 116,319,610		probably benign	Het
Rab28	A	T	5: 41,625,790	S216T	probably benign	Het
Rrp1b	A	T	17: 32,056,845	R455S	possibly damaging	Het
Sash1	A	T	10: 8,729,932	M898K	probably benign	Het
Scn8a	C	T	15: 100,970,204	T310I	probably benign	Het
Secisbp2l	C	A	2: 125,740,339	D1066Y	probably damaging	Het
Sipa1l2	A	G	8: 125,480,148		probably benign	Het
Slc12a1	A	G	2: 125,194,193	T662A	probably benign	Het
Slc22a27	A	G	19: 7,909,727	S266P	probably damaging	Het
Slc25a14	G	A	X: 48,651,963	V210I	probably benign	Het
Slit1	T	A	19: 41,630,776	N762I	probably damaging	Het
Spata31d1b	C	A	13: 59,718,021	D994E	possibly damaging	Het
Sphk1	A	G	11: 116,535,850	I204V	probably benign	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
Svs1	A	T	6: 48,990,073	K652*	probably null	Het
Tet2	T	C	3: 133,488,638	T12A	possibly damaging	Het
Tgfbi	A	T	13: 56,614,314	Q70L	possibly damaging	Het
Tlr9	T	C	9: 106,224,647	L379P	probably damaging	Het
Tnrc6c	A	G	11: 117,756,023	D1450G	possibly damaging	Het
Tra2b	A	G	16: 22,255,045		probably benign	Het
Trit1	T	C	4: 123,054,240	I451T	probably benign	Het
Trnau1ap	A	G	4: 132,321,803	Y30H	probably damaging	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Ush2a	A	G	1: 188,951,561	D4979G	probably null	Het
Usp50	C	T	2: 126,778,023	R123Q	probably benign	Het
Vmn2r117	A	T	17: 23,477,480	Y318N	probably damaging	Het
Whamm	C	T	7: 81,578,299	T304I	probably null	Het
Wipf2	C	T	11: 98,892,410	R221*	probably null	Het
Ythdf3	A	G	3: 16,205,092	N468D	possibly damaging	Het
Zbtb17	T	C	4: 141,465,548	I486T	possibly damaging	Het
Zfp3	T	C	11: 70,771,376	S54P	probably benign	Het
Zscan10	A	T	17: 23,609,852	H379L	probably damaging	Het

Other mutations in Slc12a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01471:Slc12a4	APN	8	105944089	missense	probably damaging	1.00
IGL01637:Slc12a4	APN	8	105960707	missense	possibly damaging	0.72
IGL01736:Slc12a4	APN	8	105945843	critical splice donor site	probably null
IGL01804:Slc12a4	APN	8	105944401	missense	probably damaging	1.00
IGL02000:Slc12a4	APN	8	105945232	missense	probably damaging	1.00
IGL02526:Slc12a4	APN	8	105949806	missense	possibly damaging	0.90
IGL03371:Slc12a4	APN	8	105950505	missense	probably null	0.99
IGL03385:Slc12a4	APN	8	105950864	unclassified	probably benign
ablution	UTSW	8	105945223	missense	probably damaging	1.00
custom	UTSW	8	105950836	missense	probably benign	0.00
Custom2	UTSW	8	105945244	critical splice acceptor site	probably null
custom3	UTSW	8	105949739	missense	probably damaging	1.00
PIT4810001:Slc12a4	UTSW	8	105951596	missense	probably benign	0.00
R0033:Slc12a4	UTSW	8	105947479	splice site	probably benign
R0200:Slc12a4	UTSW	8	105951617	missense	probably benign	0.09
R0201:Slc12a4	UTSW	8	105945350	missense	possibly damaging	0.79
R0270:Slc12a4	UTSW	8	105945389	missense	probably benign	0.10
R0389:Slc12a4	UTSW	8	105951967	missense	probably benign	0.00
R0432:Slc12a4	UTSW	8	105959488	missense	probably damaging	1.00
R0751:Slc12a4	UTSW	8	105951900	missense	probably damaging	1.00
R1717:Slc12a4	UTSW	8	105947571	splice site	probably null
R1792:Slc12a4	UTSW	8	105951843	missense	possibly damaging	0.91
R3115:Slc12a4	UTSW	8	105959459	missense	probably damaging	1.00
R4898:Slc12a4	UTSW	8	105944609	missense	probably damaging	1.00
R5182:Slc12a4	UTSW	8	105944606	missense	probably damaging	1.00
R5220:Slc12a4	UTSW	8	105953852	missense	probably damaging	1.00
R5283:Slc12a4	UTSW	8	105950694	critical splice donor site	probably null
R5367:Slc12a4	UTSW	8	105951634	missense	probably damaging	0.99
R5610:Slc12a4	UTSW	8	105950213	missense	possibly damaging	0.87
R5921:Slc12a4	UTSW	8	105945244	critical splice acceptor site	probably null
R6060:Slc12a4	UTSW	8	105945706	missense	probably damaging	1.00
R6182:Slc12a4	UTSW	8	105947899	missense	probably damaging	1.00
R6722:Slc12a4	UTSW	8	105944250	splice site	probably null
R6800:Slc12a4	UTSW	8	105949739	missense	probably damaging	1.00
R6956:Slc12a4	UTSW	8	105953852	missense	probably damaging	1.00
R7032:Slc12a4	UTSW	8	105949233	missense	probably damaging	1.00
R7092:Slc12a4	UTSW	8	105945223	missense	probably damaging	1.00
R7229:Slc12a4	UTSW	8	105946737	missense	probably benign	0.05
R7243:Slc12a4	UTSW	8	105953920	missense	probably damaging	1.00
R7323:Slc12a4	UTSW	8	105955715	missense	probably damaging	1.00
R7325:Slc12a4	UTSW	8	105955715	missense	probably damaging	1.00
R7327:Slc12a4	UTSW	8	105955715	missense	probably damaging	1.00
R7426:Slc12a4	UTSW	8	105950836	missense	probably benign	0.00
R7569:Slc12a4	UTSW	8	105945847	missense	probably damaging	1.00
R7710:Slc12a4	UTSW	8	105945571	missense	possibly damaging	0.95
R7968:Slc12a4	UTSW	8	105951605	missense	possibly damaging	0.94
R7970:Slc12a4	UTSW	8	105951605	missense	possibly damaging	0.94
R7971:Slc12a4	UTSW	8	105951605	missense	possibly damaging	0.94
R7972:Slc12a4	UTSW	8	105951605	missense	possibly damaging	0.94
R7973:Slc12a4	UTSW	8	105951605	missense	possibly damaging	0.94
R8221:Slc12a4	UTSW	8	105951969	missense	probably benign	0.00
R8386:Slc12a4	UTSW	8	105951618	missense	probably damaging	1.00
R8393:Slc12a4	UTSW	8	105951819	missense	probably damaging	0.99
R8751:Slc12a4	UTSW	8	105949653	critical splice donor site	probably null
R8786:Slc12a4	UTSW	8	105953917	missense	probably damaging	1.00
R8792:Slc12a4	UTSW	8	105946758	missense	probably damaging	1.00
R8941:Slc12a4	UTSW	8	105946690	critical splice donor site	probably null
R8965:Slc12a4	UTSW	8	105945350	missense	possibly damaging	0.79
R9100:Slc12a4	UTSW	8	105949142	missense	probably benign	0.30
R9113:Slc12a4	UTSW	8	105944352	missense	probably benign	0.09
X0019:Slc12a4	UTSW	8	105944352	missense	probably damaging	0.98
Z1177:Slc12a4	UTSW	8	105946732	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- ACTTTAACCCTGGCCCTTGG -3'
(R):5'- TTGCACTGCATTCACATTTACACAC -3'

Sequencing Primer
(F):5'- TAAAGGTCTTCCAGGCACGTG -3'
(R):5'- TGCATTCACATTTACACACACACAC -3'

Posted On

2014-07-14