Mutagenetix > Incidental Mutation

Incidental Mutation 'R1940:Tlr9'

213936

Institutional Source

Beutler Lab

Gene Symbol

Tlr9

Ensembl Gene

ENSMUSG00000045322

Gene Name

toll-like receptor 9

Synonyms

MMRRC Submission

039958-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R1940 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106222598-106226883 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106224647 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 379 (L379P)

Ref Sequence

ENSEMBL: ENSMUSP00000082207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062241]

AlphaFold

Q9EQU3

PDB Structure

Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062241
AA Change: L379P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: L379P

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

Meta Mutation Damage Score

0.9665

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.8%
20x: 93.7%

Validation Efficiency

98% (108/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,233,852	S2496R	probably damaging	Het
Abca16	T	C	7: 120,433,609		probably benign	Het
Ace2	A	T	X: 164,156,528	M123L	possibly damaging	Het
Acvr1c	A	T	2: 58,283,505	N248K	probably damaging	Het
Adam24	A	T	8: 40,681,361	R623*	probably null	Het
Agbl2	T	A	2: 90,811,282	L752Q	probably damaging	Het
Ankrd26	A	T	6: 118,511,693	F1335Y	probably damaging	Het
Ankrd34a	A	G	3: 96,598,676	S399G	probably benign	Het
Ap3d1	G	A	10: 80,709,773	P1041S	probably benign	Het
Arid3b	A	T	9: 57,796,148	M466K	possibly damaging	Het
Arsj	T	C	3: 126,438,346	I247T	probably damaging	Het
AU016765	G	A	17: 64,519,878		noncoding transcript	Het
Azin2	C	T	4: 128,950,784		probably null	Het
Bcat2	T	C	7: 45,588,368	Y313H	possibly damaging	Het
Cables2	A	G	2: 180,260,080	V465A	probably damaging	Het
Ccdc60	G	A	5: 116,126,165	H517Y	probably damaging	Het
Cd55b	A	T	1: 130,418,106		probably null	Het
Cdc40	G	A	10: 40,883,071		probably benign	Het
Cdh7	G	A	1: 110,049,024	V140I	probably benign	Het
Cfi	T	C	3: 129,858,828		probably benign	Het
Chit1	G	A	1: 134,145,418		probably null	Het
Chn1	A	G	2: 73,624,901	C39R	probably damaging	Het
Ciao1	A	G	2: 127,246,460	S148P	possibly damaging	Het
Clmn	G	A	12: 104,790,102	T163I	probably damaging	Het
Cngb1	C	A	8: 95,299,692	G154W	probably damaging	Het
Col19a1	A	T	1: 24,264,750	C1117*	probably null	Het
Cyp2d10	T	A	15: 82,405,294	I206F	probably benign	Het
Ddrgk1	G	T	2: 130,663,560		probably benign	Het
Ddx18	A	T	1: 121,555,224	V611D	probably damaging	Het
Dnah8	A	T	17: 30,731,207	H2000L	probably damaging	Het
Duox1	T	C	2: 122,325,984	V464A	probably benign	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Eif4enif1	A	G	11: 3,243,279	H857R	probably damaging	Het
Elmo2	A	G	2: 165,292,050		probably benign	Het
Fam171b	CCAGCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGCAGC	2: 83,812,874		probably benign	Het
Glrx	A	G	13: 75,840,137	I57V	probably benign	Het
Gm281	A	T	14: 13,828,582	M726K	probably null	Het
Golm1	A	T	13: 59,642,237		probably benign	Het
Grm3	G	A	5: 9,511,682	R723W	probably damaging	Het
Gsta3	G	A	1: 21,257,377	R45Q	probably benign	Het
Gtf3c3	A	C	1: 54,428,958		probably benign	Het
Hk3	C	T	13: 55,011,391	V451I	probably damaging	Het
Hoxa10	C	A	6: 52,234,370	G189C	possibly damaging	Het
Hs3st3b1	T	C	11: 63,889,743	D186G	probably benign	Het
Hscb	G	T	5: 110,836,060	H63N	probably benign	Het
Itpr3	A	G	17: 27,111,217	E1603G	probably damaging	Het
Ivl	T	A	3: 92,572,749	H3L	probably benign	Het
Klhl26	C	A	8: 70,452,261	R252L	probably damaging	Het
Krt31	T	A	11: 100,048,243	T251S	probably benign	Het
Lama5	T	C	2: 180,190,921	N1646S	probably benign	Het
Lhx3	T	C	2: 26,203,962	D83G	probably benign	Het
Lss	C	A	10: 76,545,462	N427K	possibly damaging	Het
Mettl24	G	A	10: 40,737,726	A154T	probably benign	Het
Mgat4a	A	T	1: 37,536,037		probably null	Het
Moxd2	C	T	6: 40,883,532	R326Q	probably damaging	Het
Mpdz	G	A	4: 81,361,443	A669V	probably benign	Het
Msra	G	A	14: 64,285,056		probably benign	Het
Muc13	A	T	16: 33,807,911	T344S	probably benign	Het
Myo3b	T	C	2: 70,258,075	I866T	probably benign	Het
Nbea	T	C	3: 55,953,100	S1852G	possibly damaging	Het
Ncf2	A	G	1: 152,834,064		probably benign	Het
Nfyc	C	A	4: 120,773,664		probably benign	Het
Nop2	T	C	6: 125,134,634	V110A	probably benign	Het
Nrg2	C	A	18: 36,196,844		probably benign	Het
Nrl	A	G	14: 55,522,435	Y12H	probably damaging	Het
Nrxn3	T	C	12: 89,260,381	V635A	probably damaging	Het
Olfr1014	T	A	2: 85,777,171	S196T	probably benign	Het
Olfr1415	T	A	1: 92,491,735	T7S	probably benign	Het
Olfr1423	A	C	19: 12,035,911	V277G	probably benign	Het
Olfr228	T	A	2: 86,483,359	K128*	probably null	Het
Papolg	A	T	11: 23,867,279	N639K	probably benign	Het
Paqr4	T	C	17: 23,737,664	I242V	probably damaging	Het
Pramel6	A	T	2: 87,508,732	K92M	probably damaging	Het
Prg4	T	C	1: 150,456,023	T300A	possibly damaging	Het
Ptprb	A	T	10: 116,319,610		probably benign	Het
Rab28	A	T	5: 41,625,790	S216T	probably benign	Het
Rrp1b	A	T	17: 32,056,845	R455S	possibly damaging	Het
Sash1	A	T	10: 8,729,932	M898K	probably benign	Het
Scn8a	C	T	15: 100,970,204	T310I	probably benign	Het
Secisbp2l	C	A	2: 125,740,339	D1066Y	probably damaging	Het
Sipa1l2	A	G	8: 125,480,148		probably benign	Het
Slc12a1	A	G	2: 125,194,193	T662A	probably benign	Het
Slc12a4	T	C	8: 105,946,037	I749V	probably benign	Het
Slc22a27	A	G	19: 7,909,727	S266P	probably damaging	Het
Slc25a14	G	A	X: 48,651,963	V210I	probably benign	Het
Slit1	T	A	19: 41,630,776	N762I	probably damaging	Het
Spata31d1b	C	A	13: 59,718,021	D994E	possibly damaging	Het
Sphk1	A	G	11: 116,535,850	I204V	probably benign	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
Svs1	A	T	6: 48,990,073	K652*	probably null	Het
Tet2	T	C	3: 133,488,638	T12A	possibly damaging	Het
Tgfbi	A	T	13: 56,614,314	Q70L	possibly damaging	Het
Tnrc6c	A	G	11: 117,756,023	D1450G	possibly damaging	Het
Tra2b	A	G	16: 22,255,045		probably benign	Het
Trit1	T	C	4: 123,054,240	I451T	probably benign	Het
Trnau1ap	A	G	4: 132,321,803	Y30H	probably damaging	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Ush2a	A	G	1: 188,951,561	D4979G	probably null	Het
Usp50	C	T	2: 126,778,023	R123Q	probably benign	Het
Vmn2r117	A	T	17: 23,477,480	Y318N	probably damaging	Het
Whamm	C	T	7: 81,578,299	T304I	probably null	Het
Wipf2	C	T	11: 98,892,410	R221*	probably null	Het
Ythdf3	A	G	3: 16,205,092	N468D	possibly damaging	Het
Zbtb17	T	C	4: 141,465,548	I486T	possibly damaging	Het
Zfp3	T	C	11: 70,771,376	S54P	probably benign	Het
Zscan10	A	T	17: 23,609,852	H379L	probably damaging	Het

Other mutations in Tlr9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Tlr9	APN	9	106225007	missense	probably damaging	1.00
IGL01764:Tlr9	APN	9	106225805	missense	probably damaging	1.00
IGL02077:Tlr9	APN	9	106225505	missense	possibly damaging	0.90
IGL02232:Tlr9	APN	9	106224937	missense	probably damaging	1.00
IGL02851:Tlr9	APN	9	106224730	nonsense	probably null
Asura	UTSW	9	106224647	missense	probably damaging	1.00
Cpg1	UTSW	9	106225007	missense	probably damaging	1.00
Cpg11	UTSW	9	106224586	missense	probably damaging	1.00
Cpg2	UTSW	9	106226465	missense	probably damaging	1.00
Cpg3	UTSW	9	106224152	missense	probably damaging	1.00
Cpg5	UTSW	9	106224689	missense	probably damaging	1.00
Cpg6	UTSW	9	106226593	missense	probably damaging	1.00
cpg7	UTSW	9	106225349	missense	probably benign	0.00
Meager	UTSW	9	106224139	missense	probably damaging	1.00
PIT4498001:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0126:Tlr9	UTSW	9	106225682	missense	probably benign	0.01
R0165:Tlr9	UTSW	9	106226087	missense	probably benign	0.10
R0534:Tlr9	UTSW	9	106224887	missense	probably benign	0.01
R0585:Tlr9	UTSW	9	106225076	missense	probably benign	0.01
R1527:Tlr9	UTSW	9	106223750	missense	probably benign	0.09
R1712:Tlr9	UTSW	9	106224049	missense	probably damaging	1.00
R1817:Tlr9	UTSW	9	106224943	missense	probably benign
R2117:Tlr9	UTSW	9	106225337	missense	probably damaging	1.00
R2656:Tlr9	UTSW	9	106223941	missense	probably benign	0.05
R3700:Tlr9	UTSW	9	106224079	missense	probably damaging	1.00
R4600:Tlr9	UTSW	9	106224533	missense	probably damaging	1.00
R4608:Tlr9	UTSW	9	106224974	missense	probably damaging	0.99
R4612:Tlr9	UTSW	9	106223807	missense	probably damaging	1.00
R4959:Tlr9	UTSW	9	106224677	missense	probably benign
R5173:Tlr9	UTSW	9	106225952	missense	possibly damaging	0.49
R5472:Tlr9	UTSW	9	106224313	missense	probably damaging	1.00
R5572:Tlr9	UTSW	9	106225637	missense	possibly damaging	0.47
R5618:Tlr9	UTSW	9	106224739	missense	possibly damaging	0.47
R5820:Tlr9	UTSW	9	106222707	critical splice donor site	probably null
R6393:Tlr9	UTSW	9	106224937	missense	probably damaging	1.00
R6397:Tlr9	UTSW	9	106225106	missense	probably damaging	1.00
R6455:Tlr9	UTSW	9	106223999	missense	probably damaging	1.00
R7385:Tlr9	UTSW	9	106225264	missense	probably damaging	1.00
R7455:Tlr9	UTSW	9	106224530	missense	probably benign	0.00
R7561:Tlr9	UTSW	9	106225949	missense	probably benign	0.00
R8889:Tlr9	UTSW	9	106222635	start gained	probably benign
R8892:Tlr9	UTSW	9	106222635	start gained	probably benign
R8926:Tlr9	UTSW	9	106226014	missense	probably benign
R9221:Tlr9	UTSW	9	106224773	missense	probably damaging	1.00
R9228:Tlr9	UTSW	9	106225553	missense	possibly damaging	0.49
R9581:Tlr9	UTSW	9	106224311	missense	probably damaging	1.00
R9689:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R9697:Tlr9	UTSW	9	106223524	nonsense	probably null
R9788:Tlr9	UTSW	9	106223807	missense	probably damaging	1.00
Z1176:Tlr9	UTSW	9	106223663	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CTTCCTGGTTCCAAGGTCTG -3'
(R):5'- TTCTGACAGCGTTGAAGGCC -3'

Sequencing Primer
(F):5'- TGCTGGACCTAAGCGAGAACTTTC -3'
(R):5'- CCACTGATGCGATTGTCTGACAAG -3'

Posted On

2014-07-14