Mutagenetix > Incidental Mutation

Incidental Mutation 'R1940:Itpr3'

213972

Institutional Source

Beutler Lab

Gene Symbol

Itpr3

Ensembl Gene

ENSMUSG00000042644

Gene Name

inositol 1,4,5-triphosphate receptor 3

Synonyms

tf, Ip3r3, Itpr-3

MMRRC Submission

039958-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1940 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27057304-27122223 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27111217 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1603 (E1603G)

Ref Sequence

ENSEMBL: ENSMUSP00000038150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049308]

AlphaFold

P70227

PDB Structure

Crystal structure of the ligand binding suppressor domain of type 3 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049308
AA Change: E1603G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038150
Gene: ENSMUSG00000042644
AA Change: E1603G

Domain	Start	End	E-Value	Type
MIR	113	167	7.75e-6	SMART
MIR	174	224	1.16e-4	SMART
MIR	232	288	1.21e-7	SMART
MIR	295	402	9.38e-14	SMART
Pfam:RYDR_ITPR	473	670	7.8e-64	PFAM
low complexity region	881	889	N/A	INTRINSIC
Pfam:RYDR_ITPR	1175	1333	5.8e-16	PFAM
low complexity region	1549	1567	N/A	INTRINSIC
low complexity region	1831	1851	N/A	INTRINSIC
Pfam:RIH_assoc	1863	1973	2.6e-34	PFAM
transmembrane domain	2203	2225	N/A	INTRINSIC
Pfam:Ion_trans	2235	2527	8.1e-20	PFAM
coiled coil region	2631	2660	N/A	INTRINSIC

Meta Mutation Damage Score

0.5570

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.8%
20x: 93.7%

Validation Efficiency

98% (108/110)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for inositol 1,4,5-trisphosphate, a second messenger that mediates the release of intracellular calcium. The receptor contains a calcium channel at the C-terminus and the ligand-binding site at the N-terminus. Knockout studies in mice suggest that type 2 and type 3 inositol 1,4,5-trisphosphate receptors play a key role in exocrine secretion underlying energy metabolism and growth. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit no apparent abnormalities in pancreatic and salivary secretion. However, one mutation in this gene results in alternating abnormal hair loss and normal hair growth throughout the life of the mouse and low sweet preference. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,233,852	S2496R	probably damaging	Het
Abca16	T	C	7: 120,433,609		probably benign	Het
Ace2	A	T	X: 164,156,528	M123L	possibly damaging	Het
Acvr1c	A	T	2: 58,283,505	N248K	probably damaging	Het
Adam24	A	T	8: 40,681,361	R623*	probably null	Het
Agbl2	T	A	2: 90,811,282	L752Q	probably damaging	Het
Ankrd26	A	T	6: 118,511,693	F1335Y	probably damaging	Het
Ankrd34a	A	G	3: 96,598,676	S399G	probably benign	Het
Ap3d1	G	A	10: 80,709,773	P1041S	probably benign	Het
Arid3b	A	T	9: 57,796,148	M466K	possibly damaging	Het
Arsj	T	C	3: 126,438,346	I247T	probably damaging	Het
AU016765	G	A	17: 64,519,878		noncoding transcript	Het
Azin2	C	T	4: 128,950,784		probably null	Het
Bcat2	T	C	7: 45,588,368	Y313H	possibly damaging	Het
Cables2	A	G	2: 180,260,080	V465A	probably damaging	Het
Ccdc60	G	A	5: 116,126,165	H517Y	probably damaging	Het
Cd55b	A	T	1: 130,418,106		probably null	Het
Cdc40	G	A	10: 40,883,071		probably benign	Het
Cdh7	G	A	1: 110,049,024	V140I	probably benign	Het
Cfi	T	C	3: 129,858,828		probably benign	Het
Chit1	G	A	1: 134,145,418		probably null	Het
Chn1	A	G	2: 73,624,901	C39R	probably damaging	Het
Ciao1	A	G	2: 127,246,460	S148P	possibly damaging	Het
Clmn	G	A	12: 104,790,102	T163I	probably damaging	Het
Cngb1	C	A	8: 95,299,692	G154W	probably damaging	Het
Col19a1	A	T	1: 24,264,750	C1117*	probably null	Het
Cyp2d10	T	A	15: 82,405,294	I206F	probably benign	Het
Ddrgk1	G	T	2: 130,663,560		probably benign	Het
Ddx18	A	T	1: 121,555,224	V611D	probably damaging	Het
Dnah8	A	T	17: 30,731,207	H2000L	probably damaging	Het
Duox1	T	C	2: 122,325,984	V464A	probably benign	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Eif4enif1	A	G	11: 3,243,279	H857R	probably damaging	Het
Elmo2	A	G	2: 165,292,050		probably benign	Het
Fam171b	CCAGCAGCAGCAGCAGCAGCAGC	CCAGCAGCAGCAGCAGCAGC	2: 83,812,874		probably benign	Het
Glrx	A	G	13: 75,840,137	I57V	probably benign	Het
Gm281	A	T	14: 13,828,582	M726K	probably null	Het
Golm1	A	T	13: 59,642,237		probably benign	Het
Grm3	G	A	5: 9,511,682	R723W	probably damaging	Het
Gsta3	G	A	1: 21,257,377	R45Q	probably benign	Het
Gtf3c3	A	C	1: 54,428,958		probably benign	Het
Hk3	C	T	13: 55,011,391	V451I	probably damaging	Het
Hoxa10	C	A	6: 52,234,370	G189C	possibly damaging	Het
Hs3st3b1	T	C	11: 63,889,743	D186G	probably benign	Het
Hscb	G	T	5: 110,836,060	H63N	probably benign	Het
Ivl	T	A	3: 92,572,749	H3L	probably benign	Het
Klhl26	C	A	8: 70,452,261	R252L	probably damaging	Het
Krt31	T	A	11: 100,048,243	T251S	probably benign	Het
Lama5	T	C	2: 180,190,921	N1646S	probably benign	Het
Lhx3	T	C	2: 26,203,962	D83G	probably benign	Het
Lss	C	A	10: 76,545,462	N427K	possibly damaging	Het
Mettl24	G	A	10: 40,737,726	A154T	probably benign	Het
Mgat4a	A	T	1: 37,536,037		probably null	Het
Moxd2	C	T	6: 40,883,532	R326Q	probably damaging	Het
Mpdz	G	A	4: 81,361,443	A669V	probably benign	Het
Msra	G	A	14: 64,285,056		probably benign	Het
Muc13	A	T	16: 33,807,911	T344S	probably benign	Het
Myo3b	T	C	2: 70,258,075	I866T	probably benign	Het
Nbea	T	C	3: 55,953,100	S1852G	possibly damaging	Het
Ncf2	A	G	1: 152,834,064		probably benign	Het
Nfyc	C	A	4: 120,773,664		probably benign	Het
Nop2	T	C	6: 125,134,634	V110A	probably benign	Het
Nrg2	C	A	18: 36,196,844		probably benign	Het
Nrl	A	G	14: 55,522,435	Y12H	probably damaging	Het
Nrxn3	T	C	12: 89,260,381	V635A	probably damaging	Het
Olfr1014	T	A	2: 85,777,171	S196T	probably benign	Het
Olfr1415	T	A	1: 92,491,735	T7S	probably benign	Het
Olfr1423	A	C	19: 12,035,911	V277G	probably benign	Het
Olfr228	T	A	2: 86,483,359	K128*	probably null	Het
Papolg	A	T	11: 23,867,279	N639K	probably benign	Het
Paqr4	T	C	17: 23,737,664	I242V	probably damaging	Het
Pramel6	A	T	2: 87,508,732	K92M	probably damaging	Het
Prg4	T	C	1: 150,456,023	T300A	possibly damaging	Het
Ptprb	A	T	10: 116,319,610		probably benign	Het
Rab28	A	T	5: 41,625,790	S216T	probably benign	Het
Rrp1b	A	T	17: 32,056,845	R455S	possibly damaging	Het
Sash1	A	T	10: 8,729,932	M898K	probably benign	Het
Scn8a	C	T	15: 100,970,204	T310I	probably benign	Het
Secisbp2l	C	A	2: 125,740,339	D1066Y	probably damaging	Het
Sipa1l2	A	G	8: 125,480,148		probably benign	Het
Slc12a1	A	G	2: 125,194,193	T662A	probably benign	Het
Slc12a4	T	C	8: 105,946,037	I749V	probably benign	Het
Slc22a27	A	G	19: 7,909,727	S266P	probably damaging	Het
Slc25a14	G	A	X: 48,651,963	V210I	probably benign	Het
Slit1	T	A	19: 41,630,776	N762I	probably damaging	Het
Spata31d1b	C	A	13: 59,718,021	D994E	possibly damaging	Het
Sphk1	A	G	11: 116,535,850	I204V	probably benign	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
Svs1	A	T	6: 48,990,073	K652*	probably null	Het
Tet2	T	C	3: 133,488,638	T12A	possibly damaging	Het
Tgfbi	A	T	13: 56,614,314	Q70L	possibly damaging	Het
Tlr9	T	C	9: 106,224,647	L379P	probably damaging	Het
Tnrc6c	A	G	11: 117,756,023	D1450G	possibly damaging	Het
Tra2b	A	G	16: 22,255,045		probably benign	Het
Trit1	T	C	4: 123,054,240	I451T	probably benign	Het
Trnau1ap	A	G	4: 132,321,803	Y30H	probably damaging	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Ush2a	A	G	1: 188,951,561	D4979G	probably null	Het
Usp50	C	T	2: 126,778,023	R123Q	probably benign	Het
Vmn2r117	A	T	17: 23,477,480	Y318N	probably damaging	Het
Whamm	C	T	7: 81,578,299	T304I	probably null	Het
Wipf2	C	T	11: 98,892,410	R221*	probably null	Het
Ythdf3	A	G	3: 16,205,092	N468D	possibly damaging	Het
Zbtb17	T	C	4: 141,465,548	I486T	possibly damaging	Het
Zfp3	T	C	11: 70,771,376	S54P	probably benign	Het
Zscan10	A	T	17: 23,609,852	H379L	probably damaging	Het

Other mutations in Itpr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Itpr3	APN	17	27083629	missense	probably benign	0.05
IGL00980:Itpr3	APN	17	27110956	missense	probably benign
IGL01151:Itpr3	APN	17	27091529	missense	probably damaging	1.00
IGL01289:Itpr3	APN	17	27099765	missense	probably damaging	0.99
IGL01403:Itpr3	APN	17	27118595	missense	probably damaging	0.97
IGL01666:Itpr3	APN	17	27117178	missense	probably benign	0.02
IGL01897:Itpr3	APN	17	27111262	missense	probably damaging	1.00
IGL02003:Itpr3	APN	17	27121475	missense	probably damaging	1.00
IGL02012:Itpr3	APN	17	27104095	missense	probably benign
IGL02063:Itpr3	APN	17	27120023	missense	probably benign	0.01
IGL02146:Itpr3	APN	17	27117275	missense	probably damaging	1.00
IGL02158:Itpr3	APN	17	27098442	missense	probably damaging	1.00
IGL02177:Itpr3	APN	17	27099614	missense	possibly damaging	0.74
IGL02247:Itpr3	APN	17	27098179	missense	probably damaging	1.00
IGL02606:Itpr3	APN	17	27114512	splice site	probably benign
IGL02651:Itpr3	APN	17	27106398	missense	probably damaging	0.99
IGL02902:Itpr3	APN	17	27104556	missense	probably benign	0.21
IGL03001:Itpr3	APN	17	27089612	splice site	probably benign
IGL03004:Itpr3	APN	17	27097978	missense	possibly damaging	0.90
IGL03065:Itpr3	APN	17	27091933	missense	probably damaging	1.00
IGL03117:Itpr3	APN	17	27119266	missense	probably damaging	1.00
IGL03181:Itpr3	APN	17	27111268	missense	probably benign
IGL03404:Itpr3	APN	17	27091518	missense	probably damaging	1.00
Allure	UTSW	17	27107303	missense	probably damaging	1.00
alopecia	UTSW	17	27095478	missense	probably damaging	0.98
Beauty	UTSW	17	27106342	missense	probably damaging	1.00
Opuesto	UTSW	17	27087592	missense	probably damaging	1.00
Paradox	UTSW	17	27098171	missense	probably damaging	1.00
Pulchritude	UTSW	17	27086960	missense	probably damaging	0.97
R0010:Itpr3	UTSW	17	27120977	missense	probably damaging	1.00
R0055:Itpr3	UTSW	17	27098322	missense	probably damaging	1.00
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0068:Itpr3	UTSW	17	27104060	splice site	probably benign
R0104:Itpr3	UTSW	17	27095992	missense	probably benign	0.01
R0195:Itpr3	UTSW	17	27114114	missense	probably damaging	1.00
R0212:Itpr3	UTSW	17	27089319	missense	probably damaging	1.00
R0454:Itpr3	UTSW	17	27113819	missense	probably benign
R0485:Itpr3	UTSW	17	27111929	missense	probably damaging	0.98
R0501:Itpr3	UTSW	17	27107289	missense	probably benign	0.09
R0781:Itpr3	UTSW	17	27110555	missense	probably benign	0.00
R0890:Itpr3	UTSW	17	27089011	nonsense	probably null
R1028:Itpr3	UTSW	17	27091369	missense	probably benign	0.04
R1144:Itpr3	UTSW	17	27114923	missense	probably benign	0.01
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1347:Itpr3	UTSW	17	27111561	missense	probably benign	0.02
R1458:Itpr3	UTSW	17	27118372	missense	probably benign	0.01
R1463:Itpr3	UTSW	17	27117154	splice site	probably benign
R1472:Itpr3	UTSW	17	27114225	missense	probably benign	0.09
R1529:Itpr3	UTSW	17	27105485	splice site	probably null
R1533:Itpr3	UTSW	17	27095560	missense	possibly damaging	0.71
R1537:Itpr3	UTSW	17	27114147	missense	possibly damaging	0.96
R1618:Itpr3	UTSW	17	27116607	critical splice acceptor site	probably null
R1672:Itpr3	UTSW	17	27089013	missense	probably benign
R1726:Itpr3	UTSW	17	27111690	missense	probably damaging	0.96
R1865:Itpr3	UTSW	17	27120023	missense	probably benign	0.01
R2023:Itpr3	UTSW	17	27102811	missense	possibly damaging	0.76
R2063:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2064:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2065:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2067:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2068:Itpr3	UTSW	17	27098076	missense	probably benign	0.19
R2219:Itpr3	UTSW	17	27115053	missense	probably benign
R2248:Itpr3	UTSW	17	27115059	missense	probably damaging	1.00
R2291:Itpr3	UTSW	17	27113579	missense	possibly damaging	0.92
R2320:Itpr3	UTSW	17	27095915	missense	probably benign
R2864:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R2865:Itpr3	UTSW	17	27091551	missense	probably benign	0.01
R3778:Itpr3	UTSW	17	27095472	missense	possibly damaging	0.57
R3881:Itpr3	UTSW	17	27113840	missense	probably benign	0.01
R3979:Itpr3	UTSW	17	27085131	missense	probably benign	0.23
R3979:Itpr3	UTSW	17	27091572	missense	probably damaging	1.00
R4224:Itpr3	UTSW	17	27107258	missense	probably damaging	1.00
R4259:Itpr3	UTSW	17	27106324	missense	probably damaging	1.00
R4321:Itpr3	UTSW	17	27111974	missense	probably benign	0.00
R4466:Itpr3	UTSW	17	27106342	missense	probably damaging	1.00
R4493:Itpr3	UTSW	17	27104612	missense	probably damaging	1.00
R4597:Itpr3	UTSW	17	27093283	missense	probably damaging	1.00
R4823:Itpr3	UTSW	17	27085147	missense	probably benign	0.30
R4921:Itpr3	UTSW	17	27098005	missense	probably damaging	1.00
R4974:Itpr3	UTSW	17	27083608	missense	probably damaging	0.96
R5063:Itpr3	UTSW	17	27089911	missense	possibly damaging	0.94
R5079:Itpr3	UTSW	17	27098423	missense	probably damaging	1.00
R5303:Itpr3	UTSW	17	27116689	missense	probably benign	0.38
R5518:Itpr3	UTSW	17	27087592	missense	probably damaging	1.00
R5521:Itpr3	UTSW	17	27107334	missense	probably benign	0.09
R5566:Itpr3	UTSW	17	27115952	missense	possibly damaging	0.71
R5567:Itpr3	UTSW	17	27103906	missense	possibly damaging	0.66
R5579:Itpr3	UTSW	17	27113519	missense	probably damaging	1.00
R5610:Itpr3	UTSW	17	27118566	missense	probably benign	0.42
R5658:Itpr3	UTSW	17	27107878	missense	possibly damaging	0.74
R5856:Itpr3	UTSW	17	27106405	missense	probably damaging	1.00
R5872:Itpr3	UTSW	17	27086976	missense	probably benign	0.02
R5878:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R5889:Itpr3	UTSW	17	27115065	missense	probably damaging	0.99
R5907:Itpr3	UTSW	17	27117893	missense	probably damaging	1.00
R5930:Itpr3	UTSW	17	27110921	missense	possibly damaging	0.49
R5987:Itpr3	UTSW	17	27104601	missense	probably damaging	1.00
R6029:Itpr3	UTSW	17	27098171	missense	probably damaging	1.00
R6195:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6213:Itpr3	UTSW	17	27111200	missense	probably benign	0.03
R6233:Itpr3	UTSW	17	27086960	missense	probably damaging	0.97
R6376:Itpr3	UTSW	17	27095475	missense	possibly damaging	0.94
R6514:Itpr3	UTSW	17	27091370	missense	probably benign
R6515:Itpr3	UTSW	17	27091370	missense	probably benign
R6516:Itpr3	UTSW	17	27091370	missense	probably benign
R6955:Itpr3	UTSW	17	27121467	missense	probably damaging	1.00
R7002:Itpr3	UTSW	17	27110580	missense	probably benign	0.00
R7064:Itpr3	UTSW	17	27089295	missense	probably damaging	1.00
R7257:Itpr3	UTSW	17	27118561	missense	probably benign	0.00
R7349:Itpr3	UTSW	17	27107812	splice site	probably null
R7469:Itpr3	UTSW	17	27121054	missense	possibly damaging	0.74
R7493:Itpr3	UTSW	17	27094800	missense	probably benign	0.09
R7510:Itpr3	UTSW	17	27089039	missense	probably damaging	0.97
R7565:Itpr3	UTSW	17	27110888	missense	probably benign	0.01
R7616:Itpr3	UTSW	17	27088977	missense	probably damaging	1.00
R7728:Itpr3	UTSW	17	27098114	missense	probably damaging	1.00
R7779:Itpr3	UTSW	17	27096063	missense	probably damaging	1.00
R7788:Itpr3	UTSW	17	27118597	nonsense	probably null
R7871:Itpr3	UTSW	17	27117179	missense	probably damaging	1.00
R7889:Itpr3	UTSW	17	27116777	missense	probably damaging	1.00
R7966:Itpr3	UTSW	17	27112028	critical splice donor site	probably null
R8065:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8067:Itpr3	UTSW	17	27110862	missense	probably benign	0.01
R8230:Itpr3	UTSW	17	27107737	critical splice donor site	probably null
R8263:Itpr3	UTSW	17	27115913	nonsense	probably null
R8264:Itpr3	UTSW	17	27104112	synonymous	silent
R8269:Itpr3	UTSW	17	27093284	missense	possibly damaging	0.60
R8271:Itpr3	UTSW	17	27087648	missense	probably damaging	1.00
R8316:Itpr3	UTSW	17	27106225	missense	possibly damaging	0.50
R8354:Itpr3	UTSW	17	27115919	missense	possibly damaging	0.74
R8413:Itpr3	UTSW	17	27111926	missense	probably damaging	1.00
R8437:Itpr3	UTSW	17	27107303	missense	probably damaging	1.00
R8676:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8679:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8846:Itpr3	UTSW	17	27112022	missense	probably damaging	1.00
R8884:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8885:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8886:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8887:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8888:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8891:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8896:Itpr3	UTSW	17	27118677	unclassified	probably benign
R8975:Itpr3	UTSW	17	27116654	missense	possibly damaging	0.56
R9025:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9026:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9063:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9087:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9088:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9089:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9090:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9091:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9200:Itpr3	UTSW	17	27107662	missense	probably damaging	0.99
R9270:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9271:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9294:Itpr3	UTSW	17	27111217	missense	probably damaging	1.00
R9389:Itpr3	UTSW	17	27095925	missense	possibly damaging	0.84
R9433:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9434:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9443:Itpr3	UTSW	17	27105549	missense	probably damaging	1.00
R9472:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9474:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9475:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9476:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9477:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9507:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9508:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9511:Itpr3	UTSW	17	27118677	unclassified	probably benign
R9694:Itpr3	UTSW	17	27115953	missense	probably damaging	0.99
R9789:Itpr3	UTSW	17	27089941	missense	probably benign	0.15
V7732:Itpr3	UTSW	17	27111024	splice site	probably benign
V7732:Itpr3	UTSW	17	27111026	splice site	probably null
Z1088:Itpr3	UTSW	17	27113528	missense	possibly damaging	0.50
Z1177:Itpr3	UTSW	17	27114929	missense	probably damaging	1.00
Z1177:Itpr3	UTSW	17	27119987	missense	probably damaging	1.00
Z31818:Itpr3	UTSW	17	27095478	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCATTGAGAAGTTACAGGTGGGC -3'
(R):5'- CCATCTCTGACACCAGGTTACC -3'

Sequencing Primer
(F):5'- CCCAGCCACCTAGGGAAG -3'
(R):5'- AGGTTACCCTGCCCAGAC -3'

Posted On

2014-07-14