Incidental Mutation 'R1941:Rbm17'
ID213985
Institutional Source Beutler Lab
Gene Symbol Rbm17
Ensembl Gene ENSMUSG00000037197
Gene NameRNA binding motif protein 17
Synonyms2700027J02Rik
MMRRC Submission 039959-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R1941 (G1)
Quality Score224
Status Not validated
Chromosome2
Chromosomal Location11585437-11604153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11589074 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 241 (K241R)
Ref Sequence ENSEMBL: ENSMUSP00000041831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040314]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040314
AA Change: K241R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041831
Gene: ENSMUSG00000037197
AA Change: K241R

DomainStartEndE-ValueType
coiled coil region 106 144 N/A INTRINSIC
low complexity region 148 166 N/A INTRINSIC
G_patch 233 279 4.97e-13 SMART
RRM 310 389 4.69e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195047
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA binding protein. The encoded protein is part of the spliceosome complex and functions in the second catalytic step of mRNA splicing. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 9 and 15. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Rbm17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Rbm17 APN 2 11595438 unclassified probably benign
R0178:Rbm17 UTSW 2 11587779 missense probably benign 0.04
R0180:Rbm17 UTSW 2 11587779 missense probably benign 0.04
R1457:Rbm17 UTSW 2 11593461 missense probably benign 0.11
R1606:Rbm17 UTSW 2 11595397 missense probably benign
R1672:Rbm17 UTSW 2 11585719 missense possibly damaging 0.95
R2327:Rbm17 UTSW 2 11598131 missense probably damaging 1.00
R2859:Rbm17 UTSW 2 11590704 missense possibly damaging 0.84
R3813:Rbm17 UTSW 2 11595435 unclassified probably benign
R5887:Rbm17 UTSW 2 11585674 missense probably damaging 1.00
R6866:Rbm17 UTSW 2 11598090 missense probably benign 0.06
R6985:Rbm17 UTSW 2 11590693 missense probably benign
R8428:Rbm17 UTSW 2 11600630 missense possibly damaging 0.80
Z1176:Rbm17 UTSW 2 11596768 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCATCCCTCTGGAATGAAGG -3'
(R):5'- ACACCCTTGAGACCTTTGACAC -3'

Sequencing Primer
(F):5'- TCTGGAATGAAGGACCCACACG -3'
(R):5'- CCTTTGACACCGGGAGTAAATTGC -3'
Posted On2014-07-14