Incidental Mutation 'R1941:Pde11a'
ID213986
Institutional Source Beutler Lab
Gene Symbol Pde11a
Ensembl Gene ENSMUSG00000075270
Gene Namephosphodiesterase 11A
SynonymsA630086N24Rik, 6330414F14Rik
MMRRC Submission 039959-MU
Accession Numbers

Genbank: NM_001081033; MGI: 3036251

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R1941 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location75989141-76338774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76291250 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 329 (R329Q)
Ref Sequence ENSEMBL: ENSMUSP00000097572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099992]
Predicted Effect probably benign
Transcript: ENSMUST00000099992
AA Change: R329Q

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097572
Gene: ENSMUSG00000075270
AA Change: R329Q

DomainStartEndE-ValueType
low complexity region 68 82 N/A INTRINSIC
low complexity region 149 164 N/A INTRINSIC
GAF 217 380 1.79e-30 SMART
GAF 402 568 2.34e-25 SMART
HDc 661 830 7.75e-6 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a member of the PDE protein superfamily. Mutations in this gene are a cause of Cushing disease and adrenocortical hyperplasia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have enlarged lateral ventricles and exhibit abnormal behavior. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Pde11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Pde11a APN 2 76215385 missense probably damaging 1.00
IGL01528:Pde11a APN 2 76194956 splice site probably benign
IGL02117:Pde11a APN 2 75991262 missense probably damaging 1.00
IGL02428:Pde11a APN 2 76046845 missense possibly damaging 0.68
IGL02455:Pde11a APN 2 76158393 missense possibly damaging 0.58
IGL02731:Pde11a APN 2 75991239 missense probably benign 0.00
IGL03068:Pde11a APN 2 76017864 missense probably damaging 1.00
IGL03081:Pde11a APN 2 76075930 splice site probably benign
D4186:Pde11a UTSW 2 76291290 missense probably damaging 1.00
R0323:Pde11a UTSW 2 76046774 splice site probably null
R0433:Pde11a UTSW 2 76337706 missense possibly damaging 0.47
R1226:Pde11a UTSW 2 76158354 missense probably benign 0.10
R1542:Pde11a UTSW 2 76046855 missense probably benign 0.25
R2107:Pde11a UTSW 2 76337922 missense probably damaging 1.00
R2394:Pde11a UTSW 2 76059061 missense probably benign 0.00
R3689:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3690:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3945:Pde11a UTSW 2 76075931 splice site probably benign
R4073:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4074:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4588:Pde11a UTSW 2 76029303 missense probably damaging 1.00
R4602:Pde11a UTSW 2 76158333 missense probably benign 0.05
R4604:Pde11a UTSW 2 76337793 missense possibly damaging 0.89
R4609:Pde11a UTSW 2 76291241 missense possibly damaging 0.94
R4610:Pde11a UTSW 2 76158333 missense probably benign 0.05
R5017:Pde11a UTSW 2 76136367 missense probably benign 0.05
R5519:Pde11a UTSW 2 76075955 missense probably damaging 1.00
R5930:Pde11a UTSW 2 76139831 splice site probably null
R6000:Pde11a UTSW 2 76017860 missense probably damaging 0.98
R6018:Pde11a UTSW 2 76017850 missense probably benign 0.00
R6913:Pde11a UTSW 2 76337740 missense probably damaging 1.00
R7117:Pde11a UTSW 2 76076004 missense probably damaging 1.00
R7258:Pde11a UTSW 2 76139906 missense possibly damaging 0.91
R7267:Pde11a UTSW 2 76337845 missense probably damaging 1.00
R7409:Pde11a UTSW 2 76005984 missense
R7451:Pde11a UTSW 2 76022773 missense possibly damaging 0.89
R7452:Pde11a UTSW 2 76136414 missense probably damaging 1.00
R7598:Pde11a UTSW 2 76136423 missense probably damaging 1.00
R7671:Pde11a UTSW 2 76215353 missense possibly damaging 0.81
R7886:Pde11a UTSW 2 76291203 missense probably benign
R7969:Pde11a UTSW 2 76291203 missense probably benign
R8045:Pde11a UTSW 2 76022728 missense probably damaging 0.99
Z1176:Pde11a UTSW 2 76194905 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTAGGACAGCATAGAGAAAGCTC -3'
(R):5'- TCCCTAAGAATAAAAGCCGGGG -3'

Sequencing Primer
(F):5'- TAGGCTAATCGAAGAACTGCTC -3'
(R):5'- GGAGAGGGGAGCTTTCCTAG -3'
Posted On2014-07-14