Incidental Mutation 'R1941:Naa15'
ID213989
Institutional Source Beutler Lab
Gene Symbol Naa15
Ensembl Gene ENSMUSG00000063273
Gene NameN(alpha)-acetyltransferase 15, NatA auxiliary subunit
Synonymstubedown, ASTBDN, Tbdn-1, mNAT1, 5730450D16Rik, Narg1
MMRRC Submission 039959-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R1941 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location51415148-51476507 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 51455934 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 346 (Y346*)
Ref Sequence ENSEMBL: ENSMUSP00000141433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029303] [ENSMUST00000193266]
Predicted Effect probably null
Transcript: ENSMUST00000029303
AA Change: Y396*
SMART Domains Protein: ENSMUSP00000029303
Gene: ENSMUSG00000063273
AA Change: Y396*

DomainStartEndE-ValueType
TPR 46 79 6.24e1 SMART
TPR 80 113 1.01e0 SMART
Blast:TPR 224 257 3e-12 BLAST
TPR 374 407 1.87e1 SMART
TPR 408 441 5.06e1 SMART
low complexity region 603 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192523
Predicted Effect probably null
Transcript: ENSMUST00000193266
AA Change: Y346*
SMART Domains Protein: ENSMUSP00000141433
Gene: ENSMUSG00000063273
AA Change: Y346*

DomainStartEndE-ValueType
Blast:TPR 1 29 3e-10 BLAST
TPR 30 63 4.9e-3 SMART
Blast:TPR 174 207 3e-12 BLAST
TPR 324 357 8.9e-2 SMART
TPR 358 391 2.4e-1 SMART
coiled coil region 533 585 N/A INTRINSIC
Blast:TPR 622 655 7e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194685
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes the auxillary subunit of the N-terminal acetyltransferase A (NatA) complex. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Naa15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Naa15 APN 3 51438405 missense probably damaging 1.00
IGL01753:Naa15 APN 3 51442853 missense probably damaging 1.00
IGL01837:Naa15 APN 3 51443948 nonsense probably null
IGL02619:Naa15 APN 3 51460131 missense probably benign 0.03
IGL02691:Naa15 APN 3 51451326 missense probably damaging 0.97
IGL02974:Naa15 APN 3 51461207 missense possibly damaging 0.95
R0009:Naa15 UTSW 3 51470219 missense probably damaging 1.00
R0010:Naa15 UTSW 3 51436213 critical splice acceptor site probably null
R0114:Naa15 UTSW 3 51448438 critical splice donor site probably null
R0411:Naa15 UTSW 3 51465639 missense possibly damaging 0.81
R1348:Naa15 UTSW 3 51465670 missense probably damaging 1.00
R3082:Naa15 UTSW 3 51460050 missense probably damaging 1.00
R4377:Naa15 UTSW 3 51448365 missense possibly damaging 0.91
R4591:Naa15 UTSW 3 51441924 missense probably damaging 1.00
R4980:Naa15 UTSW 3 51458752 critical splice donor site probably null
R5087:Naa15 UTSW 3 51457285 splice site probably null
R5139:Naa15 UTSW 3 51443840 missense probably damaging 1.00
R5289:Naa15 UTSW 3 51455894 missense probably damaging 1.00
R5527:Naa15 UTSW 3 51441947 missense probably damaging 1.00
R5776:Naa15 UTSW 3 51460026 missense probably damaging 0.96
R5909:Naa15 UTSW 3 51460064 missense probably damaging 1.00
R6034:Naa15 UTSW 3 51442821 missense probably damaging 0.98
R6034:Naa15 UTSW 3 51442821 missense probably damaging 0.98
R6194:Naa15 UTSW 3 51463300 missense probably benign 0.00
R6291:Naa15 UTSW 3 51442791 missense probably damaging 1.00
R6522:Naa15 UTSW 3 51471514 missense probably damaging 1.00
R6731:Naa15 UTSW 3 51455873 missense probably damaging 1.00
R6984:Naa15 UTSW 3 51472600 missense probably benign 0.10
R7040:Naa15 UTSW 3 51472784 missense possibly damaging 0.89
R7091:Naa15 UTSW 3 51458756 splice site probably null
R7380:Naa15 UTSW 3 51459847 intron probably null
R7685:Naa15 UTSW 3 51469974 intron probably null
R7781:Naa15 UTSW 3 51471483 critical splice acceptor site probably null
R7797:Naa15 UTSW 3 51448610 missense probably damaging 0.99
R7836:Naa15 UTSW 3 51463267 nonsense probably null
R7919:Naa15 UTSW 3 51463267 nonsense probably null
X0020:Naa15 UTSW 3 51470132 missense probably benign 0.00
X0061:Naa15 UTSW 3 51448600 missense probably damaging 1.00
X0061:Naa15 UTSW 3 51448601 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGGTCTTAAATGTGCTTAGCTGTAG -3'
(R):5'- AAATGTGGCTATGACAAGTCCAAG -3'

Sequencing Primer
(F):5'- AATGTGCTTAGCTGTAGATTATAGC -3'
(R):5'- CCTTATAAGGAAAGGGGGGT -3'
Posted On2014-07-14