Incidental Mutation 'R1941:Otud7a'
ID214004
Institutional Source Beutler Lab
Gene Symbol Otud7a
Ensembl Gene ENSMUSG00000033510
Gene NameOTU domain containing 7A
SynonymsCezanne 2 protein, Otud7
MMRRC Submission 039959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R1941 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location63444751-63759028 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 63729826 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 273 (R273*)
Ref Sequence ENSEMBL: ENSMUSP00000135559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058476] [ENSMUST00000177534]
Predicted Effect probably null
Transcript: ENSMUST00000058476
AA Change: R267*
SMART Domains Protein: ENSMUSP00000057282
Gene: ENSMUSG00000033510
AA Change: R267*

DomainStartEndE-ValueType
PDB:2L2D|A 11 82 4e-43 PDB
Pfam:OTU 207 371 1.5e-26 PFAM
low complexity region 478 510 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 559 581 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 730 777 N/A INTRINSIC
low complexity region 834 844 N/A INTRINSIC
low complexity region 865 872 N/A INTRINSIC
Pfam:zf-A20 888 912 4.3e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177534
AA Change: R273*
SMART Domains Protein: ENSMUSP00000135559
Gene: ENSMUSG00000033510
AA Change: R273*

DomainStartEndE-ValueType
Pfam:UBA_4 28 66 2e-7 PFAM
Pfam:OTU 206 377 5.7e-32 PFAM
low complexity region 484 516 N/A INTRINSIC
low complexity region 533 553 N/A INTRINSIC
low complexity region 565 587 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinizing enzyme and possible tumor suppressor. The encoded protein acts on TNF receptor associated factor 6 (TRAF6) to control nuclear factor kappa B expression. However, this gene is downregulated by SNAIL1 in hepatocellular carcinoma cells, contributing to their progression and malignancy. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, abnormal spike wave discharge, decreased dendritic spine density, decreased prepulse inhibition, impaired coordination, decreased grip strength, decreased startle reflex, impaired ultrasonic vocalization and delayed tooth eruption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Otud7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:Otud7a UTSW 7 63735801 missense probably benign 0.32
R0241:Otud7a UTSW 7 63697244 splice site probably benign
R0576:Otud7a UTSW 7 63685518 missense possibly damaging 0.93
R0594:Otud7a UTSW 7 63727472 nonsense probably null
R0611:Otud7a UTSW 7 63735890 missense possibly damaging 0.84
R1473:Otud7a UTSW 7 63754629 splice site probably benign
R1519:Otud7a UTSW 7 63758643 missense probably damaging 1.00
R1694:Otud7a UTSW 7 63733710 missense probably damaging 1.00
R1952:Otud7a UTSW 7 63650876 missense probably damaging 0.96
R2199:Otud7a UTSW 7 63757656 missense possibly damaging 0.53
R2404:Otud7a UTSW 7 63697151 missense probably benign 0.20
R4238:Otud7a UTSW 7 63650954 missense probably damaging 1.00
R4239:Otud7a UTSW 7 63650954 missense probably damaging 1.00
R4294:Otud7a UTSW 7 63697191 missense probably damaging 0.99
R4512:Otud7a UTSW 7 63729877 missense probably benign 0.32
R4748:Otud7a UTSW 7 63735915 missense possibly damaging 0.73
R4815:Otud7a UTSW 7 63729910 critical splice donor site probably null
R4942:Otud7a UTSW 7 63757423 missense probably damaging 0.99
R5249:Otud7a UTSW 7 63757433 missense possibly damaging 0.53
R5332:Otud7a UTSW 7 63735826 missense probably damaging 0.98
R5438:Otud7a UTSW 7 63757459 missense unknown
R6185:Otud7a UTSW 7 63758385 missense probably damaging 0.99
R7099:Otud7a UTSW 7 63757455 missense possibly damaging 0.72
R7893:Otud7a UTSW 7 63758552 missense probably damaging 1.00
R7976:Otud7a UTSW 7 63758552 missense probably damaging 1.00
Z1176:Otud7a UTSW 7 63758700 missense unknown
Predicted Primers PCR Primer
(F):5'- GACTCTCCAGCTCTGAAATCAG -3'
(R):5'- TTCTGCTACCTGGCTAGCATG -3'

Sequencing Primer
(F):5'- ATACAGGGGACACTTGCAGATATGTC -3'
(R):5'- TAGCATGCAGGGTCACTTC -3'
Posted On2014-07-14