Incidental Mutation 'R1941:Kank2'
ID214013
Institutional Source Beutler Lab
Gene Symbol Kank2
Ensembl Gene ENSMUSG00000032194
Gene NameKN motif and ankyrin repeat domains 2
SynonymsAnkrd25
MMRRC Submission 039959-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R1941 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21766784-21798744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21772866 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 689 (L689P)
Ref Sequence ENSEMBL: ENSMUSP00000034717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034717] [ENSMUST00000216008]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034717
AA Change: L689P

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034717
Gene: ENSMUSG00000032194
AA Change: L689P

DomainStartEndE-ValueType
Pfam:KN_motif 31 69 9.6e-26 PFAM
low complexity region 139 157 N/A INTRINSIC
coiled coil region 213 229 N/A INTRINSIC
coiled coil region 284 316 N/A INTRINSIC
low complexity region 324 343 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
ANK 658 688 6.36e-3 SMART
ANK 692 725 7.29e2 SMART
ANK 730 759 4.97e-5 SMART
ANK 763 793 3.85e-2 SMART
ANK 797 825 1.06e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216008
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KN motif and ankyrin repeat domains (KANK) family of proteins, which play a role in cytoskeletal formation by regulating actin polymerization. The encoded protein functions in the sequestration of steroid receptor coactivators and possibly other proteins. Mutations in this gene are associated with impaired kidney podocyte function and nephrotic syndrome, and keratoderma and woolly hair. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Kank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Kank2 APN 9 21780479 splice site probably benign
IGL01574:Kank2 APN 9 21794604 missense probably damaging 1.00
IGL01624:Kank2 APN 9 21780380 missense probably damaging 1.00
IGL02752:Kank2 APN 9 21795033 missense probably damaging 1.00
IGL03116:Kank2 APN 9 21772764 missense probably damaging 0.96
IGL03133:Kank2 APN 9 21795641 missense probably null 0.82
IGL03384:Kank2 APN 9 21774578 missense possibly damaging 0.82
PIT4515001:Kank2 UTSW 9 21794883 missense probably benign
R0054:Kank2 UTSW 9 21774674 nonsense probably null
R0480:Kank2 UTSW 9 21779899 missense probably damaging 1.00
R1270:Kank2 UTSW 9 21772760 missense probably damaging 1.00
R1538:Kank2 UTSW 9 21774631 missense probably damaging 0.99
R1574:Kank2 UTSW 9 21774575 missense probably damaging 1.00
R1574:Kank2 UTSW 9 21774575 missense probably damaging 1.00
R1602:Kank2 UTSW 9 21769837 missense probably damaging 1.00
R1827:Kank2 UTSW 9 21795465 missense probably damaging 1.00
R1976:Kank2 UTSW 9 21794561 missense probably damaging 0.97
R2276:Kank2 UTSW 9 21769784 missense probably damaging 1.00
R2278:Kank2 UTSW 9 21769784 missense probably damaging 1.00
R2303:Kank2 UTSW 9 21769765 missense probably benign 0.12
R4085:Kank2 UTSW 9 21795119 missense probably damaging 1.00
R4163:Kank2 UTSW 9 21795568 missense probably damaging 1.00
R4204:Kank2 UTSW 9 21795627 missense probably damaging 1.00
R4461:Kank2 UTSW 9 21794745 nonsense probably null
R4738:Kank2 UTSW 9 21774619 missense probably damaging 1.00
R4811:Kank2 UTSW 9 21775747 missense probably damaging 1.00
R4859:Kank2 UTSW 9 21779782 missense probably benign 0.13
R5838:Kank2 UTSW 9 21795393 missense probably damaging 0.99
R6449:Kank2 UTSW 9 21780562 missense possibly damaging 0.68
R7131:Kank2 UTSW 9 21794679 missense probably benign 0.02
Z1177:Kank2 UTSW 9 21795249 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGCCTGGAGTTAATGAAG -3'
(R):5'- TGCTCTCCACAGTGATGAAC -3'

Sequencing Primer
(F):5'- AATGACCTGAGTTTAATCCCTGGGC -3'
(R):5'- GCTCTCCACAGTGATGAACAAGTG -3'
Posted On2014-07-14