Incidental Mutation 'R1941:Ttk'
ID214015
Institutional Source Beutler Lab
Gene Symbol Ttk
Ensembl Gene ENSMUSG00000038379
Gene NameTtk protein kinase
SynonymsMps1, Esk1
MMRRC Submission 039959-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R1941 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location83834689-83872389 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 83853126 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 422 (S422A)
Ref Sequence ENSEMBL: ENSMUSP00000139956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070326] [ENSMUST00000185913]
Predicted Effect probably benign
Transcript: ENSMUST00000070326
AA Change: S422A

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064839
Gene: ENSMUSG00000038379
AA Change: S422A

DomainStartEndE-ValueType
PDB:4B94|D 55 235 7e-97 PDB
low complexity region 459 487 N/A INTRINSIC
S_TKc 498 764 1.14e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185913
AA Change: S422A

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139956
Gene: ENSMUSG00000038379
AA Change: S422A

DomainStartEndE-ValueType
PDB:4B94|D 55 235 2e-97 PDB
low complexity region 459 487 N/A INTRINSIC
Pfam:Pkinase 498 661 7.9e-36 PFAM
Pfam:Pkinase_Tyr 498 661 6.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188445
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual specificity protein kinase with the ability to phosphorylate tyrosine, serine and threonine. Associated with cell proliferation, this protein is essential for chromosome alignment at the centromere during mitosis and is required for centrosome duplication. It has been found to be a critical mitotic checkpoint protein for accurate segregation of chromosomes during mitosis. Tumorigenesis may occur when this protein fails to degrade and produces excess centrosomes resulting in aberrant mitotic spindles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a floxed allele activated in oocytes exhibit reduced female fertility associated with defective spindle assembly checkpoint, premature chromosome segregation, and accelerated anaphase and polar body extrusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Ttk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00721:Ttk APN 9 83863448 missense probably damaging 1.00
IGL01298:Ttk APN 9 83865142 missense probably benign 0.27
IGL02806:Ttk APN 9 83862487 nonsense probably null
IGL03080:Ttk APN 9 83843083 missense probably damaging 1.00
R0396:Ttk UTSW 9 83847260 unclassified probably benign
R0507:Ttk UTSW 9 83868067 missense probably damaging 0.97
R0827:Ttk UTSW 9 83843915 missense probably benign
R1077:Ttk UTSW 9 83844149 unclassified probably benign
R1730:Ttk UTSW 9 83868592 missense possibly damaging 0.86
R1844:Ttk UTSW 9 83854862 missense possibly damaging 0.55
R1856:Ttk UTSW 9 83869263 missense probably damaging 1.00
R2191:Ttk UTSW 9 83862183 missense probably damaging 0.99
R3737:Ttk UTSW 9 83854837 missense possibly damaging 0.88
R4035:Ttk UTSW 9 83854837 missense possibly damaging 0.88
R4903:Ttk UTSW 9 83865148 missense probably benign 0.42
R4908:Ttk UTSW 9 83843686 missense possibly damaging 0.96
R4966:Ttk UTSW 9 83865148 missense probably benign 0.42
R5023:Ttk UTSW 9 83863541 missense probably damaging 1.00
R5197:Ttk UTSW 9 83839341 missense probably benign
R5567:Ttk UTSW 9 83862535 missense possibly damaging 0.94
R6022:Ttk UTSW 9 83839322 missense probably damaging 1.00
R6900:Ttk UTSW 9 83872030 missense probably damaging 0.96
R7039:Ttk UTSW 9 83868092 missense probably damaging 1.00
R7373:Ttk UTSW 9 83854877 missense probably benign 0.00
R7715:Ttk UTSW 9 83865153 missense probably benign 0.10
R7846:Ttk UTSW 9 83843679 missense probably benign 0.27
R7929:Ttk UTSW 9 83843679 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGGATACGGGTGTGCACAC -3'
(R):5'- CTGATGCTGAGAAAGAAAGTAATTTCC -3'

Sequencing Primer
(F):5'- AAGAGTCATGGTGCCTCTTCACAG -3'
(R):5'- TCTGAGCTCAGGGCAAAA -3'
Posted On2014-07-14