Incidental Mutation 'R1941:Cep162'
ID214016
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
MMRRC Submission 039959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R1941 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 87199995 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1286 (I1286L)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably benign
Transcript: ENSMUST00000093802
AA Change: I1286L

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: I1286L

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157106
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
R7924:Cep162 UTSW 9 87244316 missense probably benign 0.00
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCATATGGTGGTTACTGTGTAAGCC -3'
(R):5'- CGTAGTATTCAAGGAGGAGCC -3'

Sequencing Primer
(F):5'- AGCCATATTAAAACAGGTTTGGG -3'
(R):5'- GAGGAGCCTTATTAGCCAAATAATTC -3'
Posted On2014-07-14