Incidental Mutation 'R1941:Olfr767'
ID 214020
Institutional Source Beutler Lab
Gene Symbol Olfr767
Ensembl Gene ENSMUSG00000059762
Gene Name olfactory receptor 767
Synonyms MOR115-1, GA_x6K02T2PULF-10765431-10764502
MMRRC Submission 039959-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R1941 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 129074825-129082910 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 129079954 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 3 (N3T)
Ref Sequence ENSEMBL: ENSMUSP00000150151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082131] [ENSMUST00000213579]
AlphaFold Q8VG33
Predicted Effect probably damaging
Transcript: ENSMUST00000082131
AA Change: N3T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080775
Gene: ENSMUSG00000059762
AA Change: N3T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.9e-49 PFAM
Pfam:7tm_1 39 288 3.6e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213579
AA Change: N3T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Olfr767
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Olfr767 APN 10 129079355 missense probably benign 0.13
IGL01945:Olfr767 APN 10 129079303 missense probably damaging 1.00
IGL02341:Olfr767 APN 10 129079461 nonsense probably null
IGL02389:Olfr767 APN 10 129079230 missense probably damaging 0.97
IGL02516:Olfr767 APN 10 129079793 missense possibly damaging 0.95
IGL02755:Olfr767 APN 10 129079196 missense probably benign 0.00
R0145:Olfr767 UTSW 10 129079363 missense probably damaging 0.97
R0453:Olfr767 UTSW 10 129079771 missense probably damaging 0.97
R0578:Olfr767 UTSW 10 129079193 missense probably damaging 1.00
R1034:Olfr767 UTSW 10 129079961 start codon destroyed probably benign 0.43
R1494:Olfr767 UTSW 10 129079615 missense probably damaging 1.00
R3707:Olfr767 UTSW 10 129079385 missense probably benign 0.31
R5405:Olfr767 UTSW 10 129079396 missense probably damaging 0.99
R5716:Olfr767 UTSW 10 129079555 missense probably benign 0.00
R8224:Olfr767 UTSW 10 129079435 missense possibly damaging 0.90
R9680:Olfr767 UTSW 10 129079489 missense probably benign 0.02
Z1177:Olfr767 UTSW 10 129080052 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- CCTGGGAATGAAGATGTTCGTG -3'
(R):5'- GCTCCATGTGAGGAAATGCAAG -3'

Sequencing Primer
(F):5'- TTCGTGAAAGAAATTTCTAGGAAGG -3'
(R):5'- CCATGTGAGGAAATGCAAGAATTTTC -3'
Posted On 2014-07-14