Incidental Mutation 'R1941:Gpx8'
ID214029
Institutional Source Beutler Lab
Gene Symbol Gpx8
Ensembl Gene ENSMUSG00000021760
Gene Nameglutathione peroxidase 8 (putative)
Synonyms2310016C16Rik
MMRRC Submission 039959-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R1941 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location113042753-113046410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113046275 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 34 (L34P)
Ref Sequence ENSEMBL: ENSMUSP00000022282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022282] [ENSMUST00000099162] [ENSMUST00000109244] [ENSMUST00000181117] [ENSMUST00000181568] [ENSMUST00000231962]
Predicted Effect probably damaging
Transcript: ENSMUST00000022282
AA Change: L34P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022282
Gene: ENSMUSG00000021760
AA Change: L34P

DomainStartEndE-ValueType
Pfam:AhpC-TSA 44 143 1.3e-8 PFAM
Pfam:GSHPx 47 155 5.3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099162
SMART Domains Protein: ENSMUSP00000096766
Gene: ENSMUSG00000074650

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109244
SMART Domains Protein: ENSMUSP00000104867
Gene: ENSMUSG00000078926

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 517 2.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181117
SMART Domains Protein: ENSMUSP00000137915
Gene: ENSMUSG00000078926

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 513 1.78e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181568
SMART Domains Protein: ENSMUSP00000137849
Gene: ENSMUSG00000078926

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 431 475 2.01e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231962
AA Change: L34P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male homozygous mice exhibit chronic active dermatitis, with epodermal hyperplasia and hyperkeratosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Gpx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Gpx8 APN 13 113045513 missense possibly damaging 0.61
IGL01110:Gpx8 APN 13 113045684 missense probably benign 0.06
IGL02190:Gpx8 APN 13 113043309 splice site probably benign
IGL03085:Gpx8 APN 13 113043261 missense probably damaging 1.00
IGL03369:Gpx8 APN 13 113043162 missense probably damaging 0.97
R0597:Gpx8 UTSW 13 113045501 missense possibly damaging 0.72
R1494:Gpx8 UTSW 13 113045615 missense possibly damaging 0.95
R1906:Gpx8 UTSW 13 113045576 missense probably damaging 1.00
R2174:Gpx8 UTSW 13 113045606 missense probably benign 0.08
R4414:Gpx8 UTSW 13 113043148 missense possibly damaging 0.69
R4860:Gpx8 UTSW 13 113045508 nonsense probably null
R4860:Gpx8 UTSW 13 113045508 nonsense probably null
R6920:Gpx8 UTSW 13 113043236 missense probably damaging 1.00
R7689:Gpx8 UTSW 13 113043177 missense probably benign 0.04
R7904:Gpx8 UTSW 13 113045501 missense probably benign 0.14
R8849:Gpx8 UTSW 13 113043170 missense probably benign 0.28
X0062:Gpx8 UTSW 13 113043175 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACCCCACTCTATGCTGAGAATAAG -3'
(R):5'- GATTCTTCTGGGAAGGGTCC -3'

Sequencing Primer
(F):5'- CTCTATGCTGAGAATAAGTGTCAGG -3'
(R):5'- GCTCTTCAGCAGCCGAAG -3'
Posted On2014-07-14