Incidental Mutation 'R1899:Prex2'
ID 214045
Institutional Source Beutler Lab
Gene Symbol Prex2
Ensembl Gene ENSMUSG00000048960
Gene Name phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms C030045D06Rik, 6230420N16Rik, Depdc2
MMRRC Submission 039919-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R1899 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 11063689-11373905 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 11232590 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 886 (E886*)
Ref Sequence ENSEMBL: ENSMUSP00000027056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027056]
AlphaFold Q3LAC4
Predicted Effect probably null
Transcript: ENSMUST00000027056
AA Change: E886*
SMART Domains Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960
AA Change: E886*

DomainStartEndE-ValueType
RhoGEF 19 205 8.61e-45 SMART
PH 238 355 2.43e-12 SMART
DEP 383 456 4.46e-26 SMART
DEP 484 557 6.57e-15 SMART
PDZ 593 666 9.62e-2 SMART
PDZ 677 744 6.37e-8 SMART
low complexity region 1112 1127 N/A INTRINSIC
low complexity region 1498 1507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187694
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,884,664 (GRCm39) Q398L probably benign Het
4930596D02Rik T G 14: 35,532,089 (GRCm39) K162T probably damaging Het
Abca8b G T 11: 109,828,744 (GRCm39) T1353K possibly damaging Het
Abcg3 A C 5: 105,086,065 (GRCm39) C565G probably damaging Het
Actr3b G A 5: 26,034,536 (GRCm39) V185I possibly damaging Het
Akap6 A T 12: 53,188,635 (GRCm39) E2016D possibly damaging Het
Aldh3b2 T C 19: 4,028,662 (GRCm39) V148A possibly damaging Het
Ankfy1 C T 11: 72,645,233 (GRCm39) Q771* probably null Het
Anks1b A G 10: 90,096,618 (GRCm39) D425G probably damaging Het
Arrb1 T C 7: 99,231,504 (GRCm39) probably benign Het
Atg2a C A 19: 6,295,097 (GRCm39) T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 (GRCm39) R617C possibly damaging Het
Bicra T C 7: 15,721,676 (GRCm39) T614A possibly damaging Het
Cacna1i A G 15: 80,275,843 (GRCm39) D167G possibly damaging Het
Calr4 T G 4: 109,103,490 (GRCm39) probably null Het
Camsap3 G T 8: 3,653,922 (GRCm39) E515* probably null Het
Casp8ap2 T C 4: 32,643,647 (GRCm39) S907P probably damaging Het
Cdk19 T A 10: 40,355,776 (GRCm39) probably benign Het
Chst14 A G 2: 118,757,496 (GRCm39) M122V possibly damaging Het
Cntn4 A G 6: 106,652,774 (GRCm39) M748V probably benign Het
Col7a1 A G 9: 108,807,956 (GRCm39) D2552G unknown Het
Cpeb2 C A 5: 43,434,930 (GRCm39) P600Q probably damaging Het
Cyp2a5 C T 7: 26,538,458 (GRCm39) R274* probably null Het
Dele1 T C 18: 38,391,395 (GRCm39) W378R probably benign Het
Dexi A G 16: 10,360,382 (GRCm39) F58S probably damaging Het
Dlg5 C A 14: 24,198,368 (GRCm39) G1522W probably damaging Het
Dock2 T C 11: 34,244,286 (GRCm39) H1048R probably benign Het
Dpp4 T C 2: 62,175,394 (GRCm39) probably benign Het
Dusp10 A T 1: 183,801,377 (GRCm39) K381N possibly damaging Het
Ercc4 A G 16: 12,965,651 (GRCm39) E761G probably damaging Het
Ern2 T C 7: 121,783,065 (GRCm39) probably benign Het
Fam83f A T 15: 80,576,281 (GRCm39) T311S probably damaging Het
Fat2 T C 11: 55,153,004 (GRCm39) D3736G probably benign Het
Fgf11 G T 11: 69,692,279 (GRCm39) T58K probably benign Het
Galntl5 C G 5: 25,403,530 (GRCm39) S167* probably null Het
Glg1 T G 8: 111,892,306 (GRCm39) E846D probably benign Het
Grm8 C A 6: 28,125,894 (GRCm39) E77D probably damaging Het
Hmcn1 A T 1: 150,533,202 (GRCm39) D3028E probably damaging Het
Htt A G 5: 35,064,429 (GRCm39) I2943V probably benign Het
Ift80 T C 3: 68,825,846 (GRCm39) K498R probably benign Het
Ipo9 A T 1: 135,327,884 (GRCm39) M509K probably damaging Het
Kcnj3 T C 2: 55,327,256 (GRCm39) V15A probably damaging Het
Kcnn3 A T 3: 89,427,762 (GRCm39) probably benign Het
Larp1b T A 3: 40,918,519 (GRCm39) D53E probably benign Het
Ltf T C 9: 110,851,913 (GRCm39) F117L possibly damaging Het
Maml1 A G 11: 50,156,957 (GRCm39) L406P probably damaging Het
Mnx1 G A 5: 29,678,955 (GRCm39) A376V unknown Het
Mroh2a G A 1: 88,163,098 (GRCm39) R376H probably benign Het
Mrpl4 A G 9: 20,918,127 (GRCm39) Y111C probably damaging Het
Mto1 T C 9: 78,368,799 (GRCm39) probably benign Het
Nalcn A T 14: 123,553,538 (GRCm39) M972K possibly damaging Het
Nemf T C 12: 69,393,152 (GRCm39) I225V probably null Het
Nipal4 T G 11: 46,041,058 (GRCm39) D379A probably damaging Het
Nktr A G 9: 121,577,932 (GRCm39) probably benign Het
Nlrp5 A G 7: 23,104,222 (GRCm39) T28A probably benign Het
Nxph1 T A 6: 9,247,622 (GRCm39) Y198N probably damaging Het
Or4c123 T C 2: 89,127,014 (GRCm39) N200S probably damaging Het
Or5an10 T C 19: 12,275,707 (GRCm39) Y263C probably damaging Het
Or8u10 A T 2: 85,916,064 (GRCm39) V19D probably benign Het
P2rx7 A G 5: 122,811,799 (GRCm39) Y370C probably benign Het
Piezo1 T C 8: 123,209,384 (GRCm39) probably benign Het
Piezo1 T C 8: 123,216,305 (GRCm39) D1401G probably damaging Het
Plxnd1 A G 6: 115,946,324 (GRCm39) L879P probably benign Het
Polr2a A T 11: 69,634,772 (GRCm39) I636N probably damaging Het
Proca1 A T 11: 78,095,847 (GRCm39) I73F probably damaging Het
Prss55 A T 14: 64,316,839 (GRCm39) V101E probably benign Het
Psg26 T A 7: 18,212,350 (GRCm39) H335L probably benign Het
Rai1 A G 11: 60,076,746 (GRCm39) E270G probably benign Het
Reep1 A G 6: 71,757,781 (GRCm39) N127D probably benign Het
Rims1 G T 1: 22,498,725 (GRCm39) P769Q probably damaging Het
Robo4 A T 9: 37,315,366 (GRCm39) probably benign Het
Ryr2 A T 13: 11,606,222 (GRCm39) D888E probably benign Het
Scamp3 A G 3: 89,087,567 (GRCm39) N135D probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sema4f A G 6: 82,895,010 (GRCm39) M395T probably benign Het
Sgip1 T C 4: 102,825,534 (GRCm39) probably null Het
Sik2 A T 9: 50,906,974 (GRCm39) probably benign Het
Smtn G T 11: 3,481,326 (GRCm39) A223D possibly damaging Het
Spen T C 4: 141,197,654 (GRCm39) T3405A probably benign Het
Srebf1 A G 11: 60,094,312 (GRCm39) L601P probably damaging Het
Srsf11 A T 3: 157,737,217 (GRCm39) probably benign Het
Tacc2 T G 7: 130,225,932 (GRCm39) S891R possibly damaging Het
Tbc1d17 T A 7: 44,491,057 (GRCm39) probably benign Het
Tgfbr3l C A 8: 4,299,600 (GRCm39) R128S probably damaging Het
Thsd1 G A 8: 22,742,334 (GRCm39) probably benign Het
Tlx3 T C 11: 33,153,072 (GRCm39) S130G probably benign Het
Tmem25 A T 9: 44,709,513 (GRCm39) probably null Het
Trak2 A T 1: 58,985,495 (GRCm39) M1K probably null Het
Trappc12 C T 12: 28,796,984 (GRCm39) E183K probably damaging Het
Ubl3 A G 5: 148,446,090 (GRCm39) V71A possibly damaging Het
Unc50 A G 1: 37,477,880 (GRCm39) Y254C probably damaging Het
Unkl T C 17: 25,448,434 (GRCm39) probably null Het
Uso1 T A 5: 92,349,051 (GRCm39) S819T probably benign Het
Yes1 A T 5: 32,802,395 (GRCm39) R103S probably damaging Het
Zfp131 A G 13: 120,228,561 (GRCm39) V396A probably damaging Het
Zfp553 T C 7: 126,834,826 (GRCm39) I127T possibly damaging Het
Zfp599 A T 9: 22,162,845 (GRCm39) N102K probably benign Het
Zmynd10 A T 9: 107,427,236 (GRCm39) Q288L probably benign Het
Other mutations in Prex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prex2 APN 1 11,256,876 (GRCm39) missense possibly damaging 0.51
IGL00948:Prex2 APN 1 11,240,838 (GRCm39) missense probably damaging 0.98
IGL01087:Prex2 APN 1 11,138,328 (GRCm39) missense probably benign 0.00
IGL01490:Prex2 APN 1 11,254,769 (GRCm39) splice site probably null
IGL01533:Prex2 APN 1 11,256,965 (GRCm39) nonsense probably null
IGL01661:Prex2 APN 1 11,278,838 (GRCm39) missense probably benign 0.01
IGL01668:Prex2 APN 1 11,223,869 (GRCm39) missense probably benign 0.00
IGL01674:Prex2 APN 1 11,240,965 (GRCm39) missense probably damaging 1.00
IGL01716:Prex2 APN 1 11,336,278 (GRCm39) missense probably benign 0.04
IGL01867:Prex2 APN 1 11,168,727 (GRCm39) missense probably benign 0.11
IGL01954:Prex2 APN 1 11,210,235 (GRCm39) missense possibly damaging 0.75
IGL01990:Prex2 APN 1 11,193,457 (GRCm39) splice site probably benign
IGL02022:Prex2 APN 1 11,367,963 (GRCm39) missense probably benign 0.04
IGL02130:Prex2 APN 1 11,230,386 (GRCm39) missense probably damaging 1.00
IGL02130:Prex2 APN 1 11,183,023 (GRCm39) missense probably damaging 1.00
IGL02221:Prex2 APN 1 11,131,569 (GRCm39) missense probably benign 0.00
IGL02369:Prex2 APN 1 11,171,393 (GRCm39) critical splice donor site probably null
IGL02440:Prex2 APN 1 11,223,881 (GRCm39) missense possibly damaging 0.94
IGL02477:Prex2 APN 1 11,274,378 (GRCm39) missense probably benign
IGL02492:Prex2 APN 1 11,194,069 (GRCm39) missense possibly damaging 0.93
IGL03051:Prex2 APN 1 11,212,889 (GRCm39) missense probably damaging 1.00
IGL03154:Prex2 APN 1 11,223,857 (GRCm39) missense possibly damaging 0.63
IGL03158:Prex2 APN 1 11,336,291 (GRCm39) missense possibly damaging 0.89
IGL03308:Prex2 APN 1 11,255,399 (GRCm39) missense possibly damaging 0.89
IGL03338:Prex2 APN 1 11,210,489 (GRCm39) missense probably benign 0.01
R0042:Prex2 UTSW 1 11,150,305 (GRCm39) missense probably damaging 1.00
R0052:Prex2 UTSW 1 11,230,380 (GRCm39) missense probably damaging 1.00
R0052:Prex2 UTSW 1 11,230,380 (GRCm39) missense probably damaging 1.00
R0138:Prex2 UTSW 1 11,355,267 (GRCm39) splice site probably benign
R0206:Prex2 UTSW 1 11,355,368 (GRCm39) missense probably damaging 1.00
R0206:Prex2 UTSW 1 11,355,368 (GRCm39) missense probably damaging 1.00
R0208:Prex2 UTSW 1 11,355,368 (GRCm39) missense probably damaging 1.00
R0325:Prex2 UTSW 1 11,270,281 (GRCm39) splice site probably null
R0326:Prex2 UTSW 1 11,355,289 (GRCm39) missense probably damaging 1.00
R0390:Prex2 UTSW 1 11,159,930 (GRCm39) splice site probably null
R0492:Prex2 UTSW 1 11,256,857 (GRCm39) splice site probably benign
R0512:Prex2 UTSW 1 11,270,157 (GRCm39) missense probably benign
R0515:Prex2 UTSW 1 11,270,098 (GRCm39) missense probably damaging 0.99
R0894:Prex2 UTSW 1 11,252,122 (GRCm39) missense probably benign
R1259:Prex2 UTSW 1 11,359,494 (GRCm39) missense probably damaging 1.00
R1332:Prex2 UTSW 1 11,274,315 (GRCm39) missense probably damaging 1.00
R1356:Prex2 UTSW 1 11,150,316 (GRCm39) nonsense probably null
R1451:Prex2 UTSW 1 11,226,483 (GRCm39) missense probably benign 0.01
R1488:Prex2 UTSW 1 11,263,752 (GRCm39) missense probably benign 0.05
R1512:Prex2 UTSW 1 11,131,554 (GRCm39) missense possibly damaging 0.64
R1641:Prex2 UTSW 1 11,301,996 (GRCm39) missense probably damaging 0.99
R1667:Prex2 UTSW 1 11,256,981 (GRCm39) missense probably benign
R1678:Prex2 UTSW 1 11,355,313 (GRCm39) missense possibly damaging 0.51
R1736:Prex2 UTSW 1 11,160,108 (GRCm39) splice site probably benign
R1781:Prex2 UTSW 1 11,270,179 (GRCm39) missense probably benign 0.17
R1804:Prex2 UTSW 1 11,202,566 (GRCm39) missense probably damaging 1.00
R1836:Prex2 UTSW 1 11,207,004 (GRCm39) missense probably damaging 1.00
R1900:Prex2 UTSW 1 11,232,590 (GRCm39) nonsense probably null
R2020:Prex2 UTSW 1 11,232,536 (GRCm39) missense probably damaging 0.98
R2114:Prex2 UTSW 1 11,256,937 (GRCm39) missense probably damaging 1.00
R2117:Prex2 UTSW 1 11,256,937 (GRCm39) missense probably damaging 1.00
R2436:Prex2 UTSW 1 11,336,376 (GRCm39) missense possibly damaging 0.90
R2902:Prex2 UTSW 1 11,278,838 (GRCm39) missense possibly damaging 0.77
R2915:Prex2 UTSW 1 11,240,077 (GRCm39) missense probably damaging 1.00
R2924:Prex2 UTSW 1 11,168,711 (GRCm39) missense probably damaging 1.00
R2981:Prex2 UTSW 1 11,252,186 (GRCm39) missense probably damaging 1.00
R3430:Prex2 UTSW 1 11,220,078 (GRCm39) missense possibly damaging 0.88
R3832:Prex2 UTSW 1 11,226,588 (GRCm39) splice site probably benign
R3870:Prex2 UTSW 1 11,230,416 (GRCm39) missense possibly damaging 0.86
R3963:Prex2 UTSW 1 11,180,581 (GRCm39) missense possibly damaging 0.93
R4012:Prex2 UTSW 1 11,254,740 (GRCm39) missense probably benign
R4030:Prex2 UTSW 1 11,278,792 (GRCm39) missense probably benign 0.06
R4214:Prex2 UTSW 1 11,355,285 (GRCm39) missense probably damaging 1.00
R4214:Prex2 UTSW 1 11,171,383 (GRCm39) missense probably damaging 1.00
R4242:Prex2 UTSW 1 11,226,528 (GRCm39) missense probably benign 0.06
R4490:Prex2 UTSW 1 11,232,487 (GRCm39) missense probably benign 0.05
R4491:Prex2 UTSW 1 11,232,487 (GRCm39) missense probably benign 0.05
R4492:Prex2 UTSW 1 11,232,487 (GRCm39) missense probably benign 0.05
R4561:Prex2 UTSW 1 11,254,769 (GRCm39) splice site probably null
R4624:Prex2 UTSW 1 11,359,489 (GRCm39) nonsense probably null
R4647:Prex2 UTSW 1 11,232,509 (GRCm39) missense probably damaging 1.00
R4657:Prex2 UTSW 1 11,136,049 (GRCm39) missense probably benign 0.00
R4706:Prex2 UTSW 1 11,270,212 (GRCm39) missense probably damaging 1.00
R4806:Prex2 UTSW 1 11,138,244 (GRCm39) missense probably damaging 1.00
R4900:Prex2 UTSW 1 11,220,129 (GRCm39) splice site probably benign
R4922:Prex2 UTSW 1 11,240,164 (GRCm39) missense probably damaging 1.00
R4961:Prex2 UTSW 1 11,168,705 (GRCm39) missense possibly damaging 0.75
R5284:Prex2 UTSW 1 11,336,314 (GRCm39) nonsense probably null
R5305:Prex2 UTSW 1 11,177,902 (GRCm39) missense probably damaging 1.00
R5307:Prex2 UTSW 1 11,270,256 (GRCm39) missense probably damaging 0.99
R5331:Prex2 UTSW 1 11,210,235 (GRCm39) missense possibly damaging 0.75
R5385:Prex2 UTSW 1 11,210,204 (GRCm39) missense probably damaging 0.99
R5574:Prex2 UTSW 1 11,210,282 (GRCm39) missense probably damaging 1.00
R5979:Prex2 UTSW 1 11,202,596 (GRCm39) missense probably damaging 1.00
R6076:Prex2 UTSW 1 11,256,174 (GRCm39) missense probably benign 0.09
R6160:Prex2 UTSW 1 11,064,075 (GRCm39) missense probably damaging 1.00
R6177:Prex2 UTSW 1 11,207,001 (GRCm39) missense possibly damaging 0.49
R6221:Prex2 UTSW 1 11,336,236 (GRCm39) missense probably benign 0.01
R6293:Prex2 UTSW 1 11,232,522 (GRCm39) missense probably benign
R6335:Prex2 UTSW 1 11,180,544 (GRCm39) missense probably benign 0.13
R6401:Prex2 UTSW 1 11,256,951 (GRCm39) missense probably benign 0.00
R6427:Prex2 UTSW 1 11,252,255 (GRCm39) missense probably damaging 1.00
R6467:Prex2 UTSW 1 11,336,259 (GRCm39) missense probably damaging 1.00
R6564:Prex2 UTSW 1 11,171,285 (GRCm39) splice site probably null
R6734:Prex2 UTSW 1 11,150,283 (GRCm39) missense probably damaging 1.00
R6753:Prex2 UTSW 1 11,254,680 (GRCm39) missense probably damaging 0.98
R6880:Prex2 UTSW 1 11,202,608 (GRCm39) missense probably damaging 1.00
R6973:Prex2 UTSW 1 11,182,967 (GRCm39) missense probably damaging 1.00
R6980:Prex2 UTSW 1 11,232,487 (GRCm39) missense probably benign 0.05
R6987:Prex2 UTSW 1 11,240,976 (GRCm39) missense probably damaging 0.99
R7085:Prex2 UTSW 1 11,168,812 (GRCm39) missense possibly damaging 0.73
R7101:Prex2 UTSW 1 11,223,833 (GRCm39) missense possibly damaging 0.86
R7106:Prex2 UTSW 1 11,207,017 (GRCm39) missense probably benign 0.33
R7319:Prex2 UTSW 1 11,232,532 (GRCm39) missense probably benign 0.10
R7342:Prex2 UTSW 1 11,232,549 (GRCm39) missense probably benign 0.00
R7469:Prex2 UTSW 1 11,355,293 (GRCm39) missense probably damaging 1.00
R7528:Prex2 UTSW 1 11,274,316 (GRCm39) missense probably damaging 1.00
R7592:Prex2 UTSW 1 11,193,437 (GRCm39) missense probably damaging 1.00
R7650:Prex2 UTSW 1 11,220,078 (GRCm39) missense possibly damaging 0.67
R7695:Prex2 UTSW 1 11,232,497 (GRCm39) missense probably benign 0.00
R7720:Prex2 UTSW 1 11,252,161 (GRCm39) missense possibly damaging 0.47
R7733:Prex2 UTSW 1 11,252,183 (GRCm39) missense probably benign 0.31
R7859:Prex2 UTSW 1 11,150,274 (GRCm39) missense probably damaging 1.00
R8247:Prex2 UTSW 1 11,270,194 (GRCm39) missense probably benign
R8300:Prex2 UTSW 1 11,301,942 (GRCm39) missense possibly damaging 0.49
R8345:Prex2 UTSW 1 11,270,118 (GRCm39) missense possibly damaging 0.65
R8352:Prex2 UTSW 1 11,355,364 (GRCm39) missense probably benign
R8352:Prex2 UTSW 1 11,355,363 (GRCm39) missense probably benign
R8410:Prex2 UTSW 1 11,223,881 (GRCm39) missense possibly damaging 0.94
R8452:Prex2 UTSW 1 11,355,364 (GRCm39) missense probably benign
R8452:Prex2 UTSW 1 11,355,363 (GRCm39) missense probably benign
R8885:Prex2 UTSW 1 11,240,799 (GRCm39) splice site probably benign
R8926:Prex2 UTSW 1 11,159,930 (GRCm39) splice site probably null
R8968:Prex2 UTSW 1 11,180,562 (GRCm39) nonsense probably null
R9049:Prex2 UTSW 1 11,256,130 (GRCm39) missense probably damaging 0.98
R9398:Prex2 UTSW 1 11,207,028 (GRCm39) missense probably benign 0.00
R9452:Prex2 UTSW 1 11,256,151 (GRCm39) missense probably benign 0.01
R9549:Prex2 UTSW 1 11,256,915 (GRCm39) missense probably damaging 1.00
RF005:Prex2 UTSW 1 11,255,390 (GRCm39) missense possibly damaging 0.47
Z1177:Prex2 UTSW 1 11,359,476 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATATGTGCTCGCATTTGAAGTC -3'
(R):5'- ACCCCTACTTAGCCTCAAGG -3'

Sequencing Primer
(F):5'- GCTCGCATTTGAAGTCCCTTTTC -3'
(R):5'- GCCTCAAGGATTTTCTTATAGCAAC -3'
Posted On 2014-07-14