Incidental Mutation 'R1899:Olfr1230'
ID214055
Institutional Source Beutler Lab
Gene Symbol Olfr1230
Ensembl Gene ENSMUSG00000075094
Gene Nameolfactory receptor 1230
SynonymsGA_x6K02T2Q125-50741934-50741017, MOR237-1
MMRRC Submission 039919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1899 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89296351-89297268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89296670 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 200 (N200S)
Ref Sequence ENSEMBL: ENSMUSP00000097375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099787] [ENSMUST00000216144]
Predicted Effect probably damaging
Transcript: ENSMUST00000099787
AA Change: N200S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097375
Gene: ENSMUSG00000075094
AA Change: N200S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 5.7e-44 PFAM
Pfam:7tm_1 39 285 6.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216144
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,258,342 W378R probably benign Het
4930522L14Rik T A 5: 109,736,798 Q398L probably benign Het
4930596D02Rik T G 14: 35,810,132 K162T probably damaging Het
Abca8b G T 11: 109,937,918 T1353K possibly damaging Het
Abcg3 A C 5: 104,938,199 C565G probably damaging Het
Actr3b G A 5: 25,829,538 V185I possibly damaging Het
Akap6 A T 12: 53,141,852 E2016D possibly damaging Het
Aldh3b2 T C 19: 3,978,662 V148A possibly damaging Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arrb1 T C 7: 99,582,297 probably benign Het
Atg2a C A 19: 6,245,067 T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 R617C possibly damaging Het
Bicra T C 7: 15,987,751 T614A possibly damaging Het
Cacna1i A G 15: 80,391,642 D167G possibly damaging Het
Calr4 T G 4: 109,246,293 probably null Het
Camsap3 G T 8: 3,603,922 E515* probably null Het
Casp8ap2 T C 4: 32,643,647 S907P probably damaging Het
Cdk19 T A 10: 40,479,780 probably benign Het
Chst14 A G 2: 118,927,015 M122V possibly damaging Het
Cntn4 A G 6: 106,675,813 M748V probably benign Het
Col7a1 A G 9: 108,978,888 D2552G unknown Het
Cpeb2 C A 5: 43,277,587 P600Q probably damaging Het
Cyp2a5 C T 7: 26,839,033 R274* probably null Het
Dexi A G 16: 10,542,518 F58S probably damaging Het
Dlg5 C A 14: 24,148,300 G1522W probably damaging Het
Dock2 T C 11: 34,294,286 H1048R probably benign Het
Dpp4 T C 2: 62,345,050 probably benign Het
Dusp10 A T 1: 184,069,180 K381N possibly damaging Het
Ercc4 A G 16: 13,147,787 E761G probably damaging Het
Ern2 T C 7: 122,183,842 probably benign Het
Fam83f A T 15: 80,692,080 T311S probably damaging Het
Fat2 T C 11: 55,262,178 D3736G probably benign Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Galntl5 C G 5: 25,198,532 S167* probably null Het
Glg1 T G 8: 111,165,674 E846D probably benign Het
Grm8 C A 6: 28,125,895 E77D probably damaging Het
Hmcn1 A T 1: 150,657,451 D3028E probably damaging Het
Htt A G 5: 34,907,085 I2943V probably benign Het
Ift80 T C 3: 68,918,513 K498R probably benign Het
Ipo9 A T 1: 135,400,146 M509K probably damaging Het
Kcnj3 T C 2: 55,437,244 V15A probably damaging Het
Kcnn3 A T 3: 89,520,455 probably benign Het
Larp1b T A 3: 40,964,084 D53E probably benign Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Maml1 A G 11: 50,266,130 L406P probably damaging Het
Mnx1 G A 5: 29,473,957 A376V unknown Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mrpl4 A G 9: 21,006,831 Y111C probably damaging Het
Mto1 T C 9: 78,461,517 probably benign Het
Nalcn A T 14: 123,316,126 M972K possibly damaging Het
Nemf T C 12: 69,346,378 I225V probably null Het
Nipal4 T G 11: 46,150,231 D379A probably damaging Het
Nktr A G 9: 121,748,866 probably benign Het
Nlrp5 A G 7: 23,404,797 T28A probably benign Het
Nxph1 T A 6: 9,247,622 Y198N probably damaging Het
Olfr1037 A T 2: 86,085,720 V19D probably benign Het
Olfr1436 T C 19: 12,298,343 Y263C probably damaging Het
P2rx7 A G 5: 122,673,736 Y370C probably benign Het
Piezo1 T C 8: 122,482,645 probably benign Het
Piezo1 T C 8: 122,489,566 D1401G probably damaging Het
Plxnd1 A G 6: 115,969,363 L879P probably benign Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prss55 A T 14: 64,079,390 V101E probably benign Het
Psg26 T A 7: 18,478,425 H335L probably benign Het
Rai1 A G 11: 60,185,920 E270G probably benign Het
Reep1 A G 6: 71,780,797 N127D probably benign Het
Rims1 G T 1: 22,428,474 P769Q probably damaging Het
Robo4 A T 9: 37,404,070 probably benign Het
Ryr2 A T 13: 11,591,336 D888E probably benign Het
Scamp3 A G 3: 89,180,260 N135D probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema4f A G 6: 82,918,029 M395T probably benign Het
Sgip1 T C 4: 102,968,337 probably null Het
Sik2 A T 9: 50,995,674 probably benign Het
Smtn G T 11: 3,531,326 A223D possibly damaging Het
Spen T C 4: 141,470,343 T3405A probably benign Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Srsf11 A T 3: 158,031,580 probably benign Het
Tacc2 T G 7: 130,624,202 S891R possibly damaging Het
Tbc1d17 T A 7: 44,841,633 probably benign Het
Tgfbr3l C A 8: 4,249,600 R128S probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tlx3 T C 11: 33,203,072 S130G probably benign Het
Tmem25 A T 9: 44,798,216 probably null Het
Trak2 A T 1: 58,946,336 M1K probably null Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Ubl3 A G 5: 148,509,280 V71A possibly damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unkl T C 17: 25,229,460 probably null Het
Uso1 T A 5: 92,201,192 S819T probably benign Het
Yes1 A T 5: 32,645,051 R103S probably damaging Het
Zfp131 A G 13: 119,767,025 V396A probably damaging Het
Zfp553 T C 7: 127,235,654 I127T possibly damaging Het
Zfp599 A T 9: 22,251,549 N102K probably benign Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Other mutations in Olfr1230
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Olfr1230 APN 2 89296455 missense probably benign 0.40
IGL01419:Olfr1230 APN 2 89296345 unclassified probably benign
IGL01644:Olfr1230 APN 2 89296632 missense probably benign 0.01
IGL01653:Olfr1230 APN 2 89297127 missense probably benign 0.08
IGL01674:Olfr1230 APN 2 89296670 missense probably damaging 1.00
IGL02124:Olfr1230 APN 2 89297063 missense probably benign 0.01
IGL03053:Olfr1230 APN 2 89296445 missense probably damaging 0.97
R0504:Olfr1230 UTSW 2 89296739 missense probably damaging 0.99
R1473:Olfr1230 UTSW 2 89296906 nonsense probably null
R1742:Olfr1230 UTSW 2 89296424 missense probably damaging 1.00
R1900:Olfr1230 UTSW 2 89296670 missense probably damaging 1.00
R1945:Olfr1230 UTSW 2 89296784 missense probably damaging 1.00
R2935:Olfr1230 UTSW 2 89297260 missense possibly damaging 0.69
R3421:Olfr1230 UTSW 2 89296553 missense probably benign 0.03
R5185:Olfr1230 UTSW 2 89296387 missense probably benign
R5377:Olfr1230 UTSW 2 89297162 missense probably damaging 0.99
R5400:Olfr1230 UTSW 2 89296913 missense probably damaging 1.00
R6083:Olfr1230 UTSW 2 89297024 missense probably damaging 1.00
R6086:Olfr1230 UTSW 2 89296854 missense probably damaging 1.00
R6155:Olfr1230 UTSW 2 89296421 missense probably damaging 1.00
R6218:Olfr1230 UTSW 2 89296962 missense probably damaging 0.98
R6361:Olfr1230 UTSW 2 89296646 missense probably damaging 0.98
R8053:Olfr1230 UTSW 2 89297196 missense possibly damaging 0.69
Z1176:Olfr1230 UTSW 2 89296953 missense probably damaging 1.00
Z1177:Olfr1230 UTSW 2 89296452 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TAGGATAAGTGACCACAGGCCTC -3'
(R):5'- GACCATTGTTAGTCCCCGAG -3'

Sequencing Primer
(F):5'- GTGACCACAGGCCTCATGTAC -3'
(R):5'- TTAGTCCCCGAGTATGCTGGC -3'
Posted On2014-07-14