Incidental Mutation 'R1899:Scamp3'
ID214059
Institutional Source Beutler Lab
Gene Symbol Scamp3
Ensembl Gene ENSMUSG00000028049
Gene Namesecretory carrier membrane protein 3
SynonymsSc3
MMRRC Submission 039919-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R1899 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89177473-89182765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89180260 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 135 (N135D)
Ref Sequence ENSEMBL: ENSMUSP00000096540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029684] [ENSMUST00000041913] [ENSMUST00000090927] [ENSMUST00000098941] [ENSMUST00000117278] [ENSMUST00000119707] [ENSMUST00000120697] [ENSMUST00000121212] [ENSMUST00000121931] [ENSMUST00000127982] [ENSMUST00000128318] [ENSMUST00000140473] [ENSMUST00000147696]
Predicted Effect probably damaging
Transcript: ENSMUST00000029684
AA Change: N135D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029684
Gene: ENSMUSG00000028049
AA Change: N135D

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 310 1.5e-76 PFAM
low complexity region 329 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041913
SMART Domains Protein: ENSMUSP00000039261
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 8e-36 PFAM
low complexity region 243 254 N/A INTRINSIC
low complexity region 390 408 N/A INTRINSIC
low complexity region 445 463 N/A INTRINSIC
low complexity region 471 490 N/A INTRINSIC
low complexity region 628 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090927
SMART Domains Protein: ENSMUSP00000088445
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 72 N/A INTRINSIC
low complexity region 105 137 N/A INTRINSIC
S_TKc 161 477 1.46e-75 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098941
AA Change: N135D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096540
Gene: ENSMUSG00000028049
AA Change: N135D

DomainStartEndE-ValueType
low complexity region 49 69 N/A INTRINSIC
coiled coil region 89 127 N/A INTRINSIC
Pfam:SCAMP 133 229 5.5e-46 PFAM
Pfam:SCAMP 227 276 2.2e-11 PFAM
low complexity region 295 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117278
SMART Domains Protein: ENSMUSP00000113706
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
Pfam:CD20 74 177 7.3e-13 PFAM
low complexity region 224 235 N/A INTRINSIC
low complexity region 371 389 N/A INTRINSIC
low complexity region 426 444 N/A INTRINSIC
low complexity region 452 471 N/A INTRINSIC
low complexity region 609 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119707
SMART Domains Protein: ENSMUSP00000113579
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-18 PFAM
low complexity region 312 330 N/A INTRINSIC
low complexity region 367 385 N/A INTRINSIC
low complexity region 393 412 N/A INTRINSIC
low complexity region 550 571 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120697
AA Change: N136D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112846
Gene: ENSMUSG00000028049
AA Change: N136D

DomainStartEndE-ValueType
low complexity region 50 70 N/A INTRINSIC
coiled coil region 90 128 N/A INTRINSIC
Pfam:SCAMP 135 310 1.1e-67 PFAM
low complexity region 330 349 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121212
SMART Domains Protein: ENSMUSP00000113390
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 138 N/A INTRINSIC
S_TKc 162 478 1.46e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121931
SMART Domains Protein: ENSMUSP00000113861
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 106 142 N/A INTRINSIC
S_TKc 163 479 1.46e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126115
Predicted Effect probably benign
Transcript: ENSMUST00000127982
SMART Domains Protein: ENSMUSP00000114855
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 77 6.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128318
SMART Domains Protein: ENSMUSP00000115761
Gene: ENSMUSG00000068917

DomainStartEndE-ValueType
low complexity region 24 50 N/A INTRINSIC
low complexity region 54 73 N/A INTRINSIC
low complexity region 103 133 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139221
Predicted Effect probably benign
Transcript: ENSMUST00000140473
Predicted Effect probably benign
Transcript: ENSMUST00000147696
SMART Domains Protein: ENSMUSP00000117185
Gene: ENSMUSG00000032657

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Pfam:CD20 36 196 1.9e-30 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 324 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156447
Meta Mutation Damage Score 0.7453 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that belongs to the secretory carrier membrane protein family. The encoded protein functions as a carrier to the cell surface in post-golgi recycling pathways. This protein is also involved in protein trafficking in endosomal pathways. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,258,342 W378R probably benign Het
4930522L14Rik T A 5: 109,736,798 Q398L probably benign Het
4930596D02Rik T G 14: 35,810,132 K162T probably damaging Het
Abca8b G T 11: 109,937,918 T1353K possibly damaging Het
Abcg3 A C 5: 104,938,199 C565G probably damaging Het
Actr3b G A 5: 25,829,538 V185I possibly damaging Het
Akap6 A T 12: 53,141,852 E2016D possibly damaging Het
Aldh3b2 T C 19: 3,978,662 V148A possibly damaging Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arrb1 T C 7: 99,582,297 probably benign Het
Atg2a C A 19: 6,245,067 T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 R617C possibly damaging Het
Bicra T C 7: 15,987,751 T614A possibly damaging Het
Cacna1i A G 15: 80,391,642 D167G possibly damaging Het
Calr4 T G 4: 109,246,293 probably null Het
Camsap3 G T 8: 3,603,922 E515* probably null Het
Casp8ap2 T C 4: 32,643,647 S907P probably damaging Het
Cdk19 T A 10: 40,479,780 probably benign Het
Chst14 A G 2: 118,927,015 M122V possibly damaging Het
Cntn4 A G 6: 106,675,813 M748V probably benign Het
Col7a1 A G 9: 108,978,888 D2552G unknown Het
Cpeb2 C A 5: 43,277,587 P600Q probably damaging Het
Cyp2a5 C T 7: 26,839,033 R274* probably null Het
Dexi A G 16: 10,542,518 F58S probably damaging Het
Dlg5 C A 14: 24,148,300 G1522W probably damaging Het
Dock2 T C 11: 34,294,286 H1048R probably benign Het
Dpp4 T C 2: 62,345,050 probably benign Het
Dusp10 A T 1: 184,069,180 K381N possibly damaging Het
Ercc4 A G 16: 13,147,787 E761G probably damaging Het
Ern2 T C 7: 122,183,842 probably benign Het
Fam83f A T 15: 80,692,080 T311S probably damaging Het
Fat2 T C 11: 55,262,178 D3736G probably benign Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Galntl5 C G 5: 25,198,532 S167* probably null Het
Glg1 T G 8: 111,165,674 E846D probably benign Het
Grm8 C A 6: 28,125,895 E77D probably damaging Het
Hmcn1 A T 1: 150,657,451 D3028E probably damaging Het
Htt A G 5: 34,907,085 I2943V probably benign Het
Ift80 T C 3: 68,918,513 K498R probably benign Het
Ipo9 A T 1: 135,400,146 M509K probably damaging Het
Kcnj3 T C 2: 55,437,244 V15A probably damaging Het
Kcnn3 A T 3: 89,520,455 probably benign Het
Larp1b T A 3: 40,964,084 D53E probably benign Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Maml1 A G 11: 50,266,130 L406P probably damaging Het
Mnx1 G A 5: 29,473,957 A376V unknown Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mrpl4 A G 9: 21,006,831 Y111C probably damaging Het
Mto1 T C 9: 78,461,517 probably benign Het
Nalcn A T 14: 123,316,126 M972K possibly damaging Het
Nemf T C 12: 69,346,378 I225V probably null Het
Nipal4 T G 11: 46,150,231 D379A probably damaging Het
Nktr A G 9: 121,748,866 probably benign Het
Nlrp5 A G 7: 23,404,797 T28A probably benign Het
Nxph1 T A 6: 9,247,622 Y198N probably damaging Het
Olfr1037 A T 2: 86,085,720 V19D probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1436 T C 19: 12,298,343 Y263C probably damaging Het
P2rx7 A G 5: 122,673,736 Y370C probably benign Het
Piezo1 T C 8: 122,482,645 probably benign Het
Piezo1 T C 8: 122,489,566 D1401G probably damaging Het
Plxnd1 A G 6: 115,969,363 L879P probably benign Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prss55 A T 14: 64,079,390 V101E probably benign Het
Psg26 T A 7: 18,478,425 H335L probably benign Het
Rai1 A G 11: 60,185,920 E270G probably benign Het
Reep1 A G 6: 71,780,797 N127D probably benign Het
Rims1 G T 1: 22,428,474 P769Q probably damaging Het
Robo4 A T 9: 37,404,070 probably benign Het
Ryr2 A T 13: 11,591,336 D888E probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema4f A G 6: 82,918,029 M395T probably benign Het
Sgip1 T C 4: 102,968,337 probably null Het
Sik2 A T 9: 50,995,674 probably benign Het
Smtn G T 11: 3,531,326 A223D possibly damaging Het
Spen T C 4: 141,470,343 T3405A probably benign Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Srsf11 A T 3: 158,031,580 probably benign Het
Tacc2 T G 7: 130,624,202 S891R possibly damaging Het
Tbc1d17 T A 7: 44,841,633 probably benign Het
Tgfbr3l C A 8: 4,249,600 R128S probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tlx3 T C 11: 33,203,072 S130G probably benign Het
Tmem25 A T 9: 44,798,216 probably null Het
Trak2 A T 1: 58,946,336 M1K probably null Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Ubl3 A G 5: 148,509,280 V71A possibly damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unkl T C 17: 25,229,460 probably null Het
Uso1 T A 5: 92,201,192 S819T probably benign Het
Yes1 A T 5: 32,645,051 R103S probably damaging Het
Zfp131 A G 13: 119,767,025 V396A probably damaging Het
Zfp553 T C 7: 127,235,654 I127T possibly damaging Het
Zfp599 A T 9: 22,251,549 N102K probably benign Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Other mutations in Scamp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Scamp3 APN 3 89177666 unclassified probably benign
IGL01362:Scamp3 APN 3 89179134 missense probably benign 0.01
IGL02269:Scamp3 APN 3 89180734 missense probably benign 0.12
R0908:Scamp3 UTSW 3 89179439 unclassified probably null
R1160:Scamp3 UTSW 3 89181198 missense probably damaging 1.00
R4237:Scamp3 UTSW 3 89181927 unclassified probably null
R4238:Scamp3 UTSW 3 89181927 unclassified probably null
R4373:Scamp3 UTSW 3 89181927 unclassified probably null
R4374:Scamp3 UTSW 3 89181927 unclassified probably null
R5013:Scamp3 UTSW 3 89180909 unclassified probably benign
R5023:Scamp3 UTSW 3 89182293 unclassified probably benign
R5057:Scamp3 UTSW 3 89182293 unclassified probably benign
R5522:Scamp3 UTSW 3 89177622 missense possibly damaging 0.90
R5762:Scamp3 UTSW 3 89181197 missense probably damaging 1.00
R6788:Scamp3 UTSW 3 89181949 missense probably benign 0.00
R7586:Scamp3 UTSW 3 89180366 missense probably damaging 1.00
R7606:Scamp3 UTSW 3 89181218 missense probably damaging 1.00
R7769:Scamp3 UTSW 3 89177991 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCCTCAGATGTTTCGAG -3'
(R):5'- AAGTGTCTTGCTCTCAGAGTTG -3'

Sequencing Primer
(F):5'- GAGCCTCAGATGTTTCGAGTAGTAAC -3'
(R):5'- TGTGGGGCATTTAATAGATTAATCTG -3'
Posted On2014-07-14