Mutagenetix > Incidental Mutation

Incidental Mutation 'R1899:Spen'

214066

Institutional Source

Beutler Lab

Gene Symbol

Spen

Ensembl Gene

ENSMUSG00000040761

Gene Name

spen family transcription repressor

Synonyms

Mint

MMRRC Submission

039919-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1899 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141467890-141538597 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 141470343 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 3405 (T3405A)

Ref Sequence

ENSEMBL: ENSMUSP00000101412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000006377

SMART Domains

Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215

Domain	Start	End	E-Value	Type
BTB	24	116	1.38e-27	SMART
low complexity region	203	222	N/A	INTRINSIC
ZnF_C2H2	297	319	6.42e-4	SMART
ZnF_C2H2	325	347	3.11e-2	SMART
ZnF_C2H2	353	375	2.49e-1	SMART
ZnF_C2H2	381	403	8.47e-4	SMART
ZnF_C2H2	409	431	8.47e-4	SMART
ZnF_C2H2	437	459	1.22e-4	SMART
ZnF_C2H2	465	487	4.94e-5	SMART
ZnF_C2H2	493	515	3.26e-5	SMART
ZnF_C2H2	521	543	7.26e-3	SMART
ZnF_C2H2	549	571	4.79e-3	SMART
ZnF_C2H2	577	599	1.58e-3	SMART
ZnF_C2H2	605	628	2.57e-3	SMART
low complexity region	654	674	N/A	INTRINSIC
ZnF_C2H2	708	730	4.4e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000078886
AA Change: T3382A

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: T3382A

Domain	Start	End	E-Value	Type
RRM	7	77	7.77e-12	SMART
low complexity region	109	121	N/A	INTRINSIC
low complexity region	235	257	N/A	INTRINSIC
low complexity region	262	311	N/A	INTRINSIC
RRM	338	411	8.6e-5	SMART
RRM	441	511	1.56e-16	SMART
RRM	520	587	1.84e-13	SMART
low complexity region	617	632	N/A	INTRINSIC
low complexity region	669	691	N/A	INTRINSIC
low complexity region	695	720	N/A	INTRINSIC
low complexity region	749	773	N/A	INTRINSIC
coiled coil region	800	825	N/A	INTRINSIC
low complexity region	830	841	N/A	INTRINSIC
internal_repeat_2	844	954	6.27e-5	PROSPERO
coiled coil region	1494	1522	N/A	INTRINSIC
low complexity region	1587	1627	N/A	INTRINSIC
low complexity region	1635	1641	N/A	INTRINSIC
low complexity region	1642	1671	N/A	INTRINSIC
low complexity region	1747	1758	N/A	INTRINSIC
low complexity region	1810	1823	N/A	INTRINSIC
low complexity region	1888	1903	N/A	INTRINSIC
low complexity region	1940	1955	N/A	INTRINSIC
low complexity region	2003	2012	N/A	INTRINSIC
internal_repeat_2	2015	2115	6.27e-5	PROSPERO
low complexity region	2127	2147	N/A	INTRINSIC
low complexity region	2169	2191	N/A	INTRINSIC
low complexity region	2207	2219	N/A	INTRINSIC
low complexity region	2304	2323	N/A	INTRINSIC
low complexity region	2332	2371	N/A	INTRINSIC
low complexity region	2396	2413	N/A	INTRINSIC
low complexity region	2518	2533	N/A	INTRINSIC
low complexity region	2545	2555	N/A	INTRINSIC
low complexity region	2696	2722	N/A	INTRINSIC
low complexity region	2931	2942	N/A	INTRINSIC
low complexity region	2994	3006	N/A	INTRINSIC
low complexity region	3192	3212	N/A	INTRINSIC
low complexity region	3299	3337	N/A	INTRINSIC
Pfam:SPOC	3465	3586	2.7e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105786
AA Change: T3405A

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: T3405A

Domain	Start	End	E-Value	Type
RRM	7	77	7.77e-12	SMART
low complexity region	109	121	N/A	INTRINSIC
low complexity region	235	257	N/A	INTRINSIC
low complexity region	262	311	N/A	INTRINSIC
RRM	338	411	8.6e-5	SMART
RRM	441	511	1.56e-16	SMART
RRM	520	587	1.84e-13	SMART
low complexity region	692	714	N/A	INTRINSIC
low complexity region	718	743	N/A	INTRINSIC
low complexity region	772	796	N/A	INTRINSIC
coiled coil region	823	848	N/A	INTRINSIC
low complexity region	853	864	N/A	INTRINSIC
internal_repeat_2	867	977	8.58e-5	PROSPERO
coiled coil region	1517	1545	N/A	INTRINSIC
low complexity region	1610	1650	N/A	INTRINSIC
low complexity region	1658	1664	N/A	INTRINSIC
low complexity region	1665	1694	N/A	INTRINSIC
low complexity region	1770	1781	N/A	INTRINSIC
low complexity region	1833	1846	N/A	INTRINSIC
low complexity region	1911	1926	N/A	INTRINSIC
low complexity region	1963	1978	N/A	INTRINSIC
low complexity region	2026	2035	N/A	INTRINSIC
internal_repeat_2	2038	2138	8.58e-5	PROSPERO
low complexity region	2150	2170	N/A	INTRINSIC
low complexity region	2192	2214	N/A	INTRINSIC
low complexity region	2230	2242	N/A	INTRINSIC
low complexity region	2327	2346	N/A	INTRINSIC
low complexity region	2355	2394	N/A	INTRINSIC
low complexity region	2419	2436	N/A	INTRINSIC
low complexity region	2541	2556	N/A	INTRINSIC
low complexity region	2568	2578	N/A	INTRINSIC
low complexity region	2719	2745	N/A	INTRINSIC
low complexity region	2954	2965	N/A	INTRINSIC
low complexity region	3017	3029	N/A	INTRINSIC
low complexity region	3215	3235	N/A	INTRINSIC
low complexity region	3322	3360	N/A	INTRINSIC
Pfam:SPOC	3488	3609	2.7e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123477

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130482

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142020

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142438

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147227

Meta Mutation Damage Score

0.0596

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.4%

Validation Efficiency

94% (94/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,258,342	W378R	probably benign	Het
4930522L14Rik	T	A	5: 109,736,798	Q398L	probably benign	Het
4930596D02Rik	T	G	14: 35,810,132	K162T	probably damaging	Het
Abca8b	G	T	11: 109,937,918	T1353K	possibly damaging	Het
Abcg3	A	C	5: 104,938,199	C565G	probably damaging	Het
Actr3b	G	A	5: 25,829,538	V185I	possibly damaging	Het
Akap6	A	T	12: 53,141,852	E2016D	possibly damaging	Het
Aldh3b2	T	C	19: 3,978,662	V148A	possibly damaging	Het
Ankfy1	C	T	11: 72,754,407	Q771*	probably null	Het
Anks1b	A	G	10: 90,260,756	D425G	probably damaging	Het
Arrb1	T	C	7: 99,582,297		probably benign	Het
Atg2a	C	A	19: 6,245,067	T170N	probably damaging	Het
Atp8b5	C	T	4: 43,361,804	R617C	possibly damaging	Het
Bicra	T	C	7: 15,987,751	T614A	possibly damaging	Het
Cacna1i	A	G	15: 80,391,642	D167G	possibly damaging	Het
Calr4	T	G	4: 109,246,293		probably null	Het
Camsap3	G	T	8: 3,603,922	E515*	probably null	Het
Casp8ap2	T	C	4: 32,643,647	S907P	probably damaging	Het
Cdk19	T	A	10: 40,479,780		probably benign	Het
Chst14	A	G	2: 118,927,015	M122V	possibly damaging	Het
Cntn4	A	G	6: 106,675,813	M748V	probably benign	Het
Col7a1	A	G	9: 108,978,888	D2552G	unknown	Het
Cpeb2	C	A	5: 43,277,587	P600Q	probably damaging	Het
Cyp2a5	C	T	7: 26,839,033	R274*	probably null	Het
Dexi	A	G	16: 10,542,518	F58S	probably damaging	Het
Dlg5	C	A	14: 24,148,300	G1522W	probably damaging	Het
Dock2	T	C	11: 34,294,286	H1048R	probably benign	Het
Dpp4	T	C	2: 62,345,050		probably benign	Het
Dusp10	A	T	1: 184,069,180	K381N	possibly damaging	Het
Ercc4	A	G	16: 13,147,787	E761G	probably damaging	Het
Ern2	T	C	7: 122,183,842		probably benign	Het
Fam83f	A	T	15: 80,692,080	T311S	probably damaging	Het
Fat2	T	C	11: 55,262,178	D3736G	probably benign	Het
Fgf11	G	T	11: 69,801,453	T58K	probably benign	Het
Galntl5	C	G	5: 25,198,532	S167*	probably null	Het
Glg1	T	G	8: 111,165,674	E846D	probably benign	Het
Grm8	C	A	6: 28,125,895	E77D	probably damaging	Het
Hmcn1	A	T	1: 150,657,451	D3028E	probably damaging	Het
Htt	A	G	5: 34,907,085	I2943V	probably benign	Het
Ift80	T	C	3: 68,918,513	K498R	probably benign	Het
Ipo9	A	T	1: 135,400,146	M509K	probably damaging	Het
Kcnj3	T	C	2: 55,437,244	V15A	probably damaging	Het
Kcnn3	A	T	3: 89,520,455		probably benign	Het
Larp1b	T	A	3: 40,964,084	D53E	probably benign	Het
Ltf	T	C	9: 111,022,845	F117L	possibly damaging	Het
Maml1	A	G	11: 50,266,130	L406P	probably damaging	Het
Mnx1	G	A	5: 29,473,957	A376V	unknown	Het
Mroh2a	G	A	1: 88,235,376	R376H	probably benign	Het
Mrpl4	A	G	9: 21,006,831	Y111C	probably damaging	Het
Mto1	T	C	9: 78,461,517		probably benign	Het
Nalcn	A	T	14: 123,316,126	M972K	possibly damaging	Het
Nemf	T	C	12: 69,346,378	I225V	probably null	Het
Nipal4	T	G	11: 46,150,231	D379A	probably damaging	Het
Nktr	A	G	9: 121,748,866		probably benign	Het
Nlrp5	A	G	7: 23,404,797	T28A	probably benign	Het
Nxph1	T	A	6: 9,247,622	Y198N	probably damaging	Het
Olfr1037	A	T	2: 86,085,720	V19D	probably benign	Het
Olfr1230	T	C	2: 89,296,670	N200S	probably damaging	Het
Olfr1436	T	C	19: 12,298,343	Y263C	probably damaging	Het
P2rx7	A	G	5: 122,673,736	Y370C	probably benign	Het
Piezo1	T	C	8: 122,482,645		probably benign	Het
Piezo1	T	C	8: 122,489,566	D1401G	probably damaging	Het
Plxnd1	A	G	6: 115,969,363	L879P	probably benign	Het
Polr2a	A	T	11: 69,743,946	I636N	probably damaging	Het
Prex2	G	T	1: 11,162,366	E886*	probably null	Het
Proca1	A	T	11: 78,205,021	I73F	probably damaging	Het
Prss55	A	T	14: 64,079,390	V101E	probably benign	Het
Psg26	T	A	7: 18,478,425	H335L	probably benign	Het
Rai1	A	G	11: 60,185,920	E270G	probably benign	Het
Reep1	A	G	6: 71,780,797	N127D	probably benign	Het
Rims1	G	T	1: 22,428,474	P769Q	probably damaging	Het
Robo4	A	T	9: 37,404,070		probably benign	Het
Ryr2	A	T	13: 11,591,336	D888E	probably benign	Het
Scamp3	A	G	3: 89,180,260	N135D	probably damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sema4f	A	G	6: 82,918,029	M395T	probably benign	Het
Sgip1	T	C	4: 102,968,337		probably null	Het
Sik2	A	T	9: 50,995,674		probably benign	Het
Smtn	G	T	11: 3,531,326	A223D	possibly damaging	Het
Srebf1	A	G	11: 60,203,486	L601P	probably damaging	Het
Srsf11	A	T	3: 158,031,580		probably benign	Het
Tacc2	T	G	7: 130,624,202	S891R	possibly damaging	Het
Tbc1d17	T	A	7: 44,841,633		probably benign	Het
Tgfbr3l	C	A	8: 4,249,600	R128S	probably damaging	Het
Thsd1	G	A	8: 22,252,318		probably benign	Het
Tlx3	T	C	11: 33,203,072	S130G	probably benign	Het
Tmem25	A	T	9: 44,798,216		probably null	Het
Trak2	A	T	1: 58,946,336	M1K	probably null	Het
Trappc12	C	T	12: 28,746,985	E183K	probably damaging	Het
Ubl3	A	G	5: 148,509,280	V71A	possibly damaging	Het
Unc50	A	G	1: 37,438,799	Y254C	probably damaging	Het
Unkl	T	C	17: 25,229,460		probably null	Het
Uso1	T	A	5: 92,201,192	S819T	probably benign	Het
Yes1	A	T	5: 32,645,051	R103S	probably damaging	Het
Zfp131	A	G	13: 119,767,025	V396A	probably damaging	Het
Zfp553	T	C	7: 127,235,654	I127T	possibly damaging	Het
Zfp599	A	T	9: 22,251,549	N102K	probably benign	Het
Zmynd10	A	T	9: 107,550,037	Q288L	probably benign	Het

Other mutations in Spen

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Spen	APN	4	141489901	missense	unknown
IGL01357:Spen	APN	4	141517113	missense	unknown
IGL02184:Spen	APN	4	141487606	missense	unknown
IGL02226:Spen	APN	4	141478146	missense	unknown
IGL02321:Spen	APN	4	141517130	missense	unknown
IGL02350:Spen	APN	4	141477579	missense	unknown
IGL02357:Spen	APN	4	141477579	missense	unknown
IGL02627:Spen	APN	4	141473015	missense	probably damaging	0.99
IGL02683:Spen	APN	4	141471645	missense	probably benign	0.06
IGL02945:Spen	APN	4	141494313	missense	unknown
IGL02950:Spen	APN	4	141469508	missense	probably damaging	1.00
IGL03008:Spen	APN	4	141476137	missense	possibly damaging	0.70
IGL03019:Spen	APN	4	141478916	missense	unknown
IGL03038:Spen	APN	4	141538239	missense	unknown
IGL03334:Spen	APN	4	141469969	missense	probably damaging	1.00
filtered	UTSW	4	141477372	missense	unknown
mentholated	UTSW	4	141469400	missense	possibly damaging	0.78
R0105:Spen	UTSW	4	141469810	splice site	probably benign
R0268:Spen	UTSW	4	141477557	missense	unknown
R0359:Spen	UTSW	4	141516870	missense	unknown
R0394:Spen	UTSW	4	141474203	missense	probably benign	0.03
R0423:Spen	UTSW	4	141479336	missense	unknown
R0433:Spen	UTSW	4	141483758	missense	unknown
R0462:Spen	UTSW	4	141473651	missense	probably damaging	1.00
R0687:Spen	UTSW	4	141488028	missense	unknown
R0699:Spen	UTSW	4	141474391	missense	possibly damaging	0.72
R0865:Spen	UTSW	4	141471870	missense	probably benign	0.11
R0918:Spen	UTSW	4	141485564	missense	unknown
R1034:Spen	UTSW	4	141475752	missense	probably benign	0.33
R1341:Spen	UTSW	4	141469400	missense	possibly damaging	0.78
R1401:Spen	UTSW	4	141471821	missense	probably damaging	0.98
R1509:Spen	UTSW	4	141475635	missense	probably benign	0.00
R1509:Spen	UTSW	4	141475700	missense	possibly damaging	0.53
R1561:Spen	UTSW	4	141472383	nonsense	probably null
R1589:Spen	UTSW	4	141488024	missense	unknown
R1640:Spen	UTSW	4	141468943	missense	probably damaging	0.98
R1758:Spen	UTSW	4	141476375	missense	unknown
R1764:Spen	UTSW	4	141472950	missense	probably damaging	1.00
R1824:Spen	UTSW	4	141472785	missense	probably damaging	1.00
R1916:Spen	UTSW	4	141472598	missense	probably damaging	1.00
R2011:Spen	UTSW	4	141473329	missense	probably damaging	1.00
R2295:Spen	UTSW	4	141477273	missense	unknown
R2379:Spen	UTSW	4	141516927	missense	unknown
R2404:Spen	UTSW	4	141477905	missense	unknown
R3719:Spen	UTSW	4	141517183	missense	unknown
R3889:Spen	UTSW	4	141477881	missense	unknown
R3945:Spen	UTSW	4	141477353	missense	unknown
R4227:Spen	UTSW	4	141522147	missense	unknown
R4326:Spen	UTSW	4	141477372	missense	unknown
R4382:Spen	UTSW	4	141473139	missense	possibly damaging	0.88
R4542:Spen	UTSW	4	141476786	missense	unknown
R4757:Spen	UTSW	4	141473079	nonsense	probably null
R4771:Spen	UTSW	4	141472596	missense	probably benign	0.14
R5072:Spen	UTSW	4	141522302	missense	unknown
R5121:Spen	UTSW	4	141476099	missense	probably benign	0.00
R5176:Spen	UTSW	4	141476276	missense	unknown
R5290:Spen	UTSW	4	141473816	missense	probably damaging	1.00
R5291:Spen	UTSW	4	141488079	missense	unknown
R5293:Spen	UTSW	4	141472406	missense	possibly damaging	0.89
R5347:Spen	UTSW	4	141471485	missense	probably benign	0.26
R5511:Spen	UTSW	4	141475064	missense	possibly damaging	0.86
R5511:Spen	UTSW	4	141516838	missense	unknown
R5772:Spen	UTSW	4	141478184	missense	unknown
R5834:Spen	UTSW	4	141471843	missense	possibly damaging	0.63
R5858:Spen	UTSW	4	141473871	missense	probably benign	0.05
R6214:Spen	UTSW	4	141479112	missense	unknown
R6232:Spen	UTSW	4	141517022	missense	unknown
R6345:Spen	UTSW	4	141471633	missense	possibly damaging	0.86
R6419:Spen	UTSW	4	141476310	missense	unknown
R6455:Spen	UTSW	4	141475509	missense	probably damaging	0.97
R6979:Spen	UTSW	4	141478063	missense	unknown
R6994:Spen	UTSW	4	141493459	missense	unknown
R7018:Spen	UTSW	4	141493444	missense	unknown
R7040:Spen	UTSW	4	141494382	missense	unknown
R7127:Spen	UTSW	4	141476108	missense	possibly damaging	0.53
R7218:Spen	UTSW	4	141472650	missense	possibly damaging	0.54
R7234:Spen	UTSW	4	141479135	missense	unknown
R7316:Spen	UTSW	4	141477054	missense	unknown
R7350:Spen	UTSW	4	141479385	missense	unknown
R7356:Spen	UTSW	4	141471924	nonsense	probably null
R7400:Spen	UTSW	4	141473741	missense	probably damaging	1.00
R7470:Spen	UTSW	4	141479294	missense	unknown
R7698:Spen	UTSW	4	141472845	missense	probably damaging	1.00
R7858:Spen	UTSW	4	141488131	splice site	probably null
R8033:Spen	UTSW	4	141471746	missense	probably benign	0.03
R8064:Spen	UTSW	4	141475700	missense	possibly damaging	0.53
R8159:Spen	UTSW	4	141475003	missense	possibly damaging	0.53
R8187:Spen	UTSW	4	141472905	missense	possibly damaging	0.93
R8463:Spen	UTSW	4	141522279	missense	unknown
R8557:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8558:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8672:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8673:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8674:Spen	UTSW	4	141470370	missense	probably benign	0.14
R8714:Spen	UTSW	4	141488003	missense	unknown
R8735:Spen	UTSW	4	141469818	missense	probably benign	0.32
R8762:Spen	UTSW	4	141472950	missense	probably damaging	1.00
R8877:Spen	UTSW	4	141471826	nonsense	probably null
R8878:Spen	UTSW	4	141477209	missense	unknown
R8937:Spen	UTSW	4	141474063	missense	probably damaging	1.00
R8939:Spen	UTSW	4	141475658	missense	possibly damaging	0.72
R8968:Spen	UTSW	4	141470390	missense	probably benign	0.02
R8971:Spen	UTSW	4	141474578	missense	possibly damaging	0.53
R9016:Spen	UTSW	4	141473627	missense	probably damaging	1.00
R9072:Spen	UTSW	4	141476391	missense	unknown
R9073:Spen	UTSW	4	141476391	missense	unknown
R9120:Spen	UTSW	4	141472922	missense
R9136:Spen	UTSW	4	141522312	missense	unknown
R9138:Spen	UTSW	4	141469486	missense	probably damaging	1.00
R9150:Spen	UTSW	4	141517157	missense	unknown
R9225:Spen	UTSW	4	141475632	missense	possibly damaging	0.53
R9492:Spen	UTSW	4	141471787	missense	probably benign	0.26
R9537:Spen	UTSW	4	141471704	missense	probably benign	0.15
R9537:Spen	UTSW	4	141516845	small deletion	probably benign
R9602:Spen	UTSW	4	141477872	missense	unknown
R9609:Spen	UTSW	4	141488108	missense	unknown
R9686:Spen	UTSW	4	141472635	missense	probably benign	0.27
R9697:Spen	UTSW	4	141468964	missense	probably damaging	1.00
R9713:Spen	UTSW	4	141517020	missense	unknown
T0722:Spen	UTSW	4	141474353	missense	probably benign	0.33
T0975:Spen	UTSW	4	141474353	missense	probably benign	0.33
Z1088:Spen	UTSW	4	141477976	missense	unknown
Z1088:Spen	UTSW	4	141477977	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AGAAGACTCTTGTTTGGGAGC -3'
(R):5'- GGCTTTTGTGCTGCCAATTC -3'

Sequencing Primer
(F):5'- GAGCTGGCTGGACTTCAG -3'
(R):5'- TTGCAGTCCACGCAGTCTG -3'

Posted On

2014-07-14