Incidental Mutation 'R1899:Spen'
ID214066
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Namespen family transcription repressor
SynonymsMint
MMRRC Submission 039919-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1899 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141467890-141538597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141470343 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3405 (T3405A)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006377] [ENSMUST00000078886] [ENSMUST00000105786]
Predicted Effect probably benign
Transcript: ENSMUST00000006377
SMART Domains Protein: ENSMUSP00000006377
Gene: ENSMUSG00000006215

DomainStartEndE-ValueType
BTB 24 116 1.38e-27 SMART
low complexity region 203 222 N/A INTRINSIC
ZnF_C2H2 297 319 6.42e-4 SMART
ZnF_C2H2 325 347 3.11e-2 SMART
ZnF_C2H2 353 375 2.49e-1 SMART
ZnF_C2H2 381 403 8.47e-4 SMART
ZnF_C2H2 409 431 8.47e-4 SMART
ZnF_C2H2 437 459 1.22e-4 SMART
ZnF_C2H2 465 487 4.94e-5 SMART
ZnF_C2H2 493 515 3.26e-5 SMART
ZnF_C2H2 521 543 7.26e-3 SMART
ZnF_C2H2 549 571 4.79e-3 SMART
ZnF_C2H2 577 599 1.58e-3 SMART
ZnF_C2H2 605 628 2.57e-3 SMART
low complexity region 654 674 N/A INTRINSIC
ZnF_C2H2 708 730 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078886
AA Change: T3382A

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: T3382A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105786
AA Change: T3405A

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: T3405A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147227
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,258,342 W378R probably benign Het
4930522L14Rik T A 5: 109,736,798 Q398L probably benign Het
4930596D02Rik T G 14: 35,810,132 K162T probably damaging Het
Abca8b G T 11: 109,937,918 T1353K possibly damaging Het
Abcg3 A C 5: 104,938,199 C565G probably damaging Het
Actr3b G A 5: 25,829,538 V185I possibly damaging Het
Akap6 A T 12: 53,141,852 E2016D possibly damaging Het
Aldh3b2 T C 19: 3,978,662 V148A possibly damaging Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arrb1 T C 7: 99,582,297 probably benign Het
Atg2a C A 19: 6,245,067 T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 R617C possibly damaging Het
Bicra T C 7: 15,987,751 T614A possibly damaging Het
Cacna1i A G 15: 80,391,642 D167G possibly damaging Het
Calr4 T G 4: 109,246,293 probably null Het
Camsap3 G T 8: 3,603,922 E515* probably null Het
Casp8ap2 T C 4: 32,643,647 S907P probably damaging Het
Cdk19 T A 10: 40,479,780 probably benign Het
Chst14 A G 2: 118,927,015 M122V possibly damaging Het
Cntn4 A G 6: 106,675,813 M748V probably benign Het
Col7a1 A G 9: 108,978,888 D2552G unknown Het
Cpeb2 C A 5: 43,277,587 P600Q probably damaging Het
Cyp2a5 C T 7: 26,839,033 R274* probably null Het
Dexi A G 16: 10,542,518 F58S probably damaging Het
Dlg5 C A 14: 24,148,300 G1522W probably damaging Het
Dock2 T C 11: 34,294,286 H1048R probably benign Het
Dpp4 T C 2: 62,345,050 probably benign Het
Dusp10 A T 1: 184,069,180 K381N possibly damaging Het
Ercc4 A G 16: 13,147,787 E761G probably damaging Het
Ern2 T C 7: 122,183,842 probably benign Het
Fam83f A T 15: 80,692,080 T311S probably damaging Het
Fat2 T C 11: 55,262,178 D3736G probably benign Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Galntl5 C G 5: 25,198,532 S167* probably null Het
Glg1 T G 8: 111,165,674 E846D probably benign Het
Grm8 C A 6: 28,125,895 E77D probably damaging Het
Hmcn1 A T 1: 150,657,451 D3028E probably damaging Het
Htt A G 5: 34,907,085 I2943V probably benign Het
Ift80 T C 3: 68,918,513 K498R probably benign Het
Ipo9 A T 1: 135,400,146 M509K probably damaging Het
Kcnj3 T C 2: 55,437,244 V15A probably damaging Het
Kcnn3 A T 3: 89,520,455 probably benign Het
Larp1b T A 3: 40,964,084 D53E probably benign Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Maml1 A G 11: 50,266,130 L406P probably damaging Het
Mnx1 G A 5: 29,473,957 A376V unknown Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mrpl4 A G 9: 21,006,831 Y111C probably damaging Het
Mto1 T C 9: 78,461,517 probably benign Het
Nalcn A T 14: 123,316,126 M972K possibly damaging Het
Nemf T C 12: 69,346,378 I225V probably null Het
Nipal4 T G 11: 46,150,231 D379A probably damaging Het
Nktr A G 9: 121,748,866 probably benign Het
Nlrp5 A G 7: 23,404,797 T28A probably benign Het
Nxph1 T A 6: 9,247,622 Y198N probably damaging Het
Olfr1037 A T 2: 86,085,720 V19D probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1436 T C 19: 12,298,343 Y263C probably damaging Het
P2rx7 A G 5: 122,673,736 Y370C probably benign Het
Piezo1 T C 8: 122,482,645 probably benign Het
Piezo1 T C 8: 122,489,566 D1401G probably damaging Het
Plxnd1 A G 6: 115,969,363 L879P probably benign Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prss55 A T 14: 64,079,390 V101E probably benign Het
Psg26 T A 7: 18,478,425 H335L probably benign Het
Rai1 A G 11: 60,185,920 E270G probably benign Het
Reep1 A G 6: 71,780,797 N127D probably benign Het
Rims1 G T 1: 22,428,474 P769Q probably damaging Het
Robo4 A T 9: 37,404,070 probably benign Het
Ryr2 A T 13: 11,591,336 D888E probably benign Het
Scamp3 A G 3: 89,180,260 N135D probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema4f A G 6: 82,918,029 M395T probably benign Het
Sgip1 T C 4: 102,968,337 probably null Het
Sik2 A T 9: 50,995,674 probably benign Het
Smtn G T 11: 3,531,326 A223D possibly damaging Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Srsf11 A T 3: 158,031,580 probably benign Het
Tacc2 T G 7: 130,624,202 S891R possibly damaging Het
Tbc1d17 T A 7: 44,841,633 probably benign Het
Tgfbr3l C A 8: 4,249,600 R128S probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tlx3 T C 11: 33,203,072 S130G probably benign Het
Tmem25 A T 9: 44,798,216 probably null Het
Trak2 A T 1: 58,946,336 M1K probably null Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Ubl3 A G 5: 148,509,280 V71A possibly damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unkl T C 17: 25,229,460 probably null Het
Uso1 T A 5: 92,201,192 S819T probably benign Het
Yes1 A T 5: 32,645,051 R103S probably damaging Het
Zfp131 A G 13: 119,767,025 V396A probably damaging Het
Zfp553 T C 7: 127,235,654 I127T possibly damaging Het
Zfp599 A T 9: 22,251,549 N102K probably benign Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R6994:Spen UTSW 4 141493459 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7127:Spen UTSW 4 141476108 missense possibly damaging 0.53
R7218:Spen UTSW 4 141472650 missense possibly damaging 0.54
R7234:Spen UTSW 4 141479135 missense unknown
R7316:Spen UTSW 4 141477054 missense unknown
R7350:Spen UTSW 4 141479385 missense unknown
R7356:Spen UTSW 4 141471924 nonsense probably null
R7400:Spen UTSW 4 141473741 missense probably damaging 1.00
R7470:Spen UTSW 4 141479294 missense unknown
R7698:Spen UTSW 4 141472845 missense probably damaging 1.00
R7941:Spen UTSW 4 141488131 splice site probably null
R8033:Spen UTSW 4 141471746 missense probably benign 0.03
R8064:Spen UTSW 4 141475700 missense possibly damaging 0.53
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAAGACTCTTGTTTGGGAGC -3'
(R):5'- GGCTTTTGTGCTGCCAATTC -3'

Sequencing Primer
(F):5'- GAGCTGGCTGGACTTCAG -3'
(R):5'- TTGCAGTCCACGCAGTCTG -3'
Posted On2014-07-14