Mutagenetix > Incidental Mutation

Incidental Mutation 'R1899:P2rx7'

214076

Institutional Source

Beutler Lab

Gene Symbol

P2rx7

Ensembl Gene

ENSMUSG00000029468

Gene Name

purinergic receptor P2X, ligand-gated ion channel, 7

Synonyms

P2X7R, P2X7 receptor, P2X(7)

MMRRC Submission

039919-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1899 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

122643911-122691432 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122673736 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 370 (Y370C)

Ref Sequence

ENSEMBL: ENSMUSP00000112440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031425] [ENSMUST00000100737] [ENSMUST00000121489]

AlphaFold

Q9Z1M0

Predicted Effect

probably benign
Transcript: ENSMUST00000031425
AA Change: Y370C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031425
Gene: ENSMUSG00000029468
AA Change: Y370C

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	403	1e-149	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000100737
AA Change: Y370C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000098303
Gene: ENSMUSG00000029468
AA Change: Y370C

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	397	3.6e-158	PFAM
low complexity region	435	451	N/A	INTRINSIC
low complexity region	516	536	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121489
AA Change: Y370C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112440
Gene: ENSMUSG00000029468
AA Change: Y370C

Domain	Start	End	E-Value	Type
Pfam:P2X_receptor	11	403	3.5e-149	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199371

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.4%

Validation Efficiency

94% (94/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and viable with no obvious phenotypic abnormality. Cellular responses of macrophages to extracellular ATP are frequently normal however. In addition, long bones are thinner than normal in adult mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,258,342	W378R	probably benign	Het
4930522L14Rik	T	A	5: 109,736,798	Q398L	probably benign	Het
4930596D02Rik	T	G	14: 35,810,132	K162T	probably damaging	Het
Abca8b	G	T	11: 109,937,918	T1353K	possibly damaging	Het
Abcg3	A	C	5: 104,938,199	C565G	probably damaging	Het
Actr3b	G	A	5: 25,829,538	V185I	possibly damaging	Het
Akap6	A	T	12: 53,141,852	E2016D	possibly damaging	Het
Aldh3b2	T	C	19: 3,978,662	V148A	possibly damaging	Het
Ankfy1	C	T	11: 72,754,407	Q771*	probably null	Het
Anks1b	A	G	10: 90,260,756	D425G	probably damaging	Het
Arrb1	T	C	7: 99,582,297		probably benign	Het
Atg2a	C	A	19: 6,245,067	T170N	probably damaging	Het
Atp8b5	C	T	4: 43,361,804	R617C	possibly damaging	Het
Bicra	T	C	7: 15,987,751	T614A	possibly damaging	Het
Cacna1i	A	G	15: 80,391,642	D167G	possibly damaging	Het
Calr4	T	G	4: 109,246,293		probably null	Het
Camsap3	G	T	8: 3,603,922	E515*	probably null	Het
Casp8ap2	T	C	4: 32,643,647	S907P	probably damaging	Het
Cdk19	T	A	10: 40,479,780		probably benign	Het
Chst14	A	G	2: 118,927,015	M122V	possibly damaging	Het
Cntn4	A	G	6: 106,675,813	M748V	probably benign	Het
Col7a1	A	G	9: 108,978,888	D2552G	unknown	Het
Cpeb2	C	A	5: 43,277,587	P600Q	probably damaging	Het
Cyp2a5	C	T	7: 26,839,033	R274*	probably null	Het
Dexi	A	G	16: 10,542,518	F58S	probably damaging	Het
Dlg5	C	A	14: 24,148,300	G1522W	probably damaging	Het
Dock2	T	C	11: 34,294,286	H1048R	probably benign	Het
Dpp4	T	C	2: 62,345,050		probably benign	Het
Dusp10	A	T	1: 184,069,180	K381N	possibly damaging	Het
Ercc4	A	G	16: 13,147,787	E761G	probably damaging	Het
Ern2	T	C	7: 122,183,842		probably benign	Het
Fam83f	A	T	15: 80,692,080	T311S	probably damaging	Het
Fat2	T	C	11: 55,262,178	D3736G	probably benign	Het
Fgf11	G	T	11: 69,801,453	T58K	probably benign	Het
Galntl5	C	G	5: 25,198,532	S167*	probably null	Het
Glg1	T	G	8: 111,165,674	E846D	probably benign	Het
Grm8	C	A	6: 28,125,895	E77D	probably damaging	Het
Hmcn1	A	T	1: 150,657,451	D3028E	probably damaging	Het
Htt	A	G	5: 34,907,085	I2943V	probably benign	Het
Ift80	T	C	3: 68,918,513	K498R	probably benign	Het
Ipo9	A	T	1: 135,400,146	M509K	probably damaging	Het
Kcnj3	T	C	2: 55,437,244	V15A	probably damaging	Het
Kcnn3	A	T	3: 89,520,455		probably benign	Het
Larp1b	T	A	3: 40,964,084	D53E	probably benign	Het
Ltf	T	C	9: 111,022,845	F117L	possibly damaging	Het
Maml1	A	G	11: 50,266,130	L406P	probably damaging	Het
Mnx1	G	A	5: 29,473,957	A376V	unknown	Het
Mroh2a	G	A	1: 88,235,376	R376H	probably benign	Het
Mrpl4	A	G	9: 21,006,831	Y111C	probably damaging	Het
Mto1	T	C	9: 78,461,517		probably benign	Het
Nalcn	A	T	14: 123,316,126	M972K	possibly damaging	Het
Nemf	T	C	12: 69,346,378	I225V	probably null	Het
Nipal4	T	G	11: 46,150,231	D379A	probably damaging	Het
Nktr	A	G	9: 121,748,866		probably benign	Het
Nlrp5	A	G	7: 23,404,797	T28A	probably benign	Het
Nxph1	T	A	6: 9,247,622	Y198N	probably damaging	Het
Olfr1037	A	T	2: 86,085,720	V19D	probably benign	Het
Olfr1230	T	C	2: 89,296,670	N200S	probably damaging	Het
Olfr1436	T	C	19: 12,298,343	Y263C	probably damaging	Het
Piezo1	T	C	8: 122,482,645		probably benign	Het
Piezo1	T	C	8: 122,489,566	D1401G	probably damaging	Het
Plxnd1	A	G	6: 115,969,363	L879P	probably benign	Het
Polr2a	A	T	11: 69,743,946	I636N	probably damaging	Het
Prex2	G	T	1: 11,162,366	E886*	probably null	Het
Proca1	A	T	11: 78,205,021	I73F	probably damaging	Het
Prss55	A	T	14: 64,079,390	V101E	probably benign	Het
Psg26	T	A	7: 18,478,425	H335L	probably benign	Het
Rai1	A	G	11: 60,185,920	E270G	probably benign	Het
Reep1	A	G	6: 71,780,797	N127D	probably benign	Het
Rims1	G	T	1: 22,428,474	P769Q	probably damaging	Het
Robo4	A	T	9: 37,404,070		probably benign	Het
Ryr2	A	T	13: 11,591,336	D888E	probably benign	Het
Scamp3	A	G	3: 89,180,260	N135D	probably damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sema4f	A	G	6: 82,918,029	M395T	probably benign	Het
Sgip1	T	C	4: 102,968,337		probably null	Het
Sik2	A	T	9: 50,995,674		probably benign	Het
Smtn	G	T	11: 3,531,326	A223D	possibly damaging	Het
Spen	T	C	4: 141,470,343	T3405A	probably benign	Het
Srebf1	A	G	11: 60,203,486	L601P	probably damaging	Het
Srsf11	A	T	3: 158,031,580		probably benign	Het
Tacc2	T	G	7: 130,624,202	S891R	possibly damaging	Het
Tbc1d17	T	A	7: 44,841,633		probably benign	Het
Tgfbr3l	C	A	8: 4,249,600	R128S	probably damaging	Het
Thsd1	G	A	8: 22,252,318		probably benign	Het
Tlx3	T	C	11: 33,203,072	S130G	probably benign	Het
Tmem25	A	T	9: 44,798,216		probably null	Het
Trak2	A	T	1: 58,946,336	M1K	probably null	Het
Trappc12	C	T	12: 28,746,985	E183K	probably damaging	Het
Ubl3	A	G	5: 148,509,280	V71A	possibly damaging	Het
Unc50	A	G	1: 37,438,799	Y254C	probably damaging	Het
Unkl	T	C	17: 25,229,460		probably null	Het
Uso1	T	A	5: 92,201,192	S819T	probably benign	Het
Yes1	A	T	5: 32,645,051	R103S	probably damaging	Het
Zfp131	A	G	13: 119,767,025	V396A	probably damaging	Het
Zfp553	T	C	7: 127,235,654	I127T	possibly damaging	Het
Zfp599	A	T	9: 22,251,549	N102K	probably benign	Het
Zmynd10	A	T	9: 107,550,037	Q288L	probably benign	Het

Other mutations in P2rx7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01534:P2rx7	APN	5	122676698	missense	probably damaging	1.00
IGL01911:P2rx7	APN	5	122658768	missense	probably damaging	0.99
IGL02375:P2rx7	APN	5	122673656	splice site	probably benign
IGL02502:P2rx7	APN	5	122680987	missense	possibly damaging	0.92
IGL03102:P2rx7	APN	5	122663605	missense	possibly damaging	0.88
IGL03179:P2rx7	APN	5	122673700	missense	possibly damaging	0.66
ailing	UTSW	5	122673736	missense	probably benign
Enfermo	UTSW	5	122652789	missense	probably damaging	0.98
Incapacitated	UTSW	5	122673793	missense	probably damaging	0.99
Sickpuppy	UTSW	5	122681003	missense	probably damaging	0.96
Stumped	UTSW	5	122652726	critical splice acceptor site	probably null
BB009:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
BB019:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
PIT1430001:P2rx7	UTSW	5	122681216	missense	probably damaging	0.99
R0363:P2rx7	UTSW	5	122657030	nonsense	probably null
R0558:P2rx7	UTSW	5	122673798	missense	possibly damaging	0.83
R1186:P2rx7	UTSW	5	122670451	missense	probably damaging	1.00
R1709:P2rx7	UTSW	5	122670465	missense	possibly damaging	0.95
R1856:P2rx7	UTSW	5	122681032	missense	probably damaging	1.00
R1905:P2rx7	UTSW	5	122680952	missense	probably damaging	1.00
R2082:P2rx7	UTSW	5	122644095	missense	possibly damaging	0.92
R2117:P2rx7	UTSW	5	122681266	missense	probably benign	0.00
R2205:P2rx7	UTSW	5	122681101	missense	probably damaging	1.00
R2446:P2rx7	UTSW	5	122680816	missense	probably benign
R3151:P2rx7	UTSW	5	122681266	missense	probably benign	0.00
R4052:P2rx7	UTSW	5	122666277	missense	probably damaging	1.00
R4883:P2rx7	UTSW	5	122681066	missense	probably damaging	1.00
R4930:P2rx7	UTSW	5	122670479	missense	probably damaging	1.00
R5194:P2rx7	UTSW	5	122673795	missense	probably benign	0.00
R5257:P2rx7	UTSW	5	122681003	missense	probably damaging	0.96
R5258:P2rx7	UTSW	5	122681003	missense	probably damaging	0.96
R5481:P2rx7	UTSW	5	122680820	missense	possibly damaging	0.89
R5656:P2rx7	UTSW	5	122673717	missense	probably damaging	0.99
R5738:P2rx7	UTSW	5	122652789	missense	probably damaging	0.98
R6587:P2rx7	UTSW	5	122664550	missense	probably damaging	1.00
R7098:P2rx7	UTSW	5	122673793	missense	probably damaging	0.99
R7120:P2rx7	UTSW	5	122681294	missense	probably benign
R7180:P2rx7	UTSW	5	122680820	missense	possibly damaging	0.89
R7358:P2rx7	UTSW	5	122666142	critical splice acceptor site	probably null
R7724:P2rx7	UTSW	5	122673373	missense	probably benign	0.07
R7932:P2rx7	UTSW	5	122644182	missense	probably benign	0.01
R8240:P2rx7	UTSW	5	122655033	missense	probably damaging	1.00
R8425:P2rx7	UTSW	5	122670458	missense	probably damaging	0.96
R9140:P2rx7	UTSW	5	122652726	critical splice acceptor site	probably null
R9331:P2rx7	UTSW	5	122680898	missense	probably benign	0.01
R9623:P2rx7	UTSW	5	122652797	missense	probably damaging	1.00
Z1177:P2rx7	UTSW	5	122663641	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGTGATCTTGCTTGGGGC -3'
(R):5'- AAACCGTGATCGCAGCTTATTC -3'

Sequencing Primer
(F):5'- CTGTAATTTGAAGGCCAGCC -3'
(R):5'- GTGATCGCAGCTTATTCTTTCCCAC -3'

Posted On

2014-07-14