Mutagenetix > Incidental Mutation

Incidental Mutation 'R1899:Grm8'

214079

Institutional Source

Beutler Lab

Gene Symbol

Grm8

Ensembl Gene

ENSMUSG00000024211

Gene Name

glutamate receptor, metabotropic 8

Synonyms

mGluR8, Gprc1h

MMRRC Submission

039919-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1899 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27275119-28135178 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 28125895 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 77 (E77D)

Ref Sequence

ENSEMBL: ENSMUSP00000120394 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897] [ENSMUST00000132755]

AlphaFold

P47743

Predicted Effect

probably damaging
Transcript: ENSMUST00000090512
AA Change: E77D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: E77D

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	9.6e-102	PFAM
Pfam:Peripla_BP_6	141	375	1.3e-9	PFAM
Pfam:NCD3G	512	562	5e-17	PFAM
Pfam:7tm_3	593	841	4.7e-88	PFAM
low complexity region	887	905	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115323
AA Change: E77D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: E77D

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	3.3e-107	PFAM
Pfam:NCD3G	512	562	9e-14	PFAM
Pfam:7tm_3	595	840	6.8e-58	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115324
AA Change: E77D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: E77D

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	478	2.1e-101	PFAM
Pfam:Peripla_BP_6	141	375	9.2e-10	PFAM
Pfam:NCD3G	512	562	2.8e-16	PFAM
Pfam:7tm_3	593	841	2.4e-87	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000131897
AA Change: E77D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211
AA Change: E77D

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	74	294	5.8e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132755

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146727

Meta Mutation Damage Score

0.2932

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.4%

Validation Efficiency

94% (94/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,258,342	W378R	probably benign	Het
4930522L14Rik	T	A	5: 109,736,798	Q398L	probably benign	Het
4930596D02Rik	T	G	14: 35,810,132	K162T	probably damaging	Het
Abca8b	G	T	11: 109,937,918	T1353K	possibly damaging	Het
Abcg3	A	C	5: 104,938,199	C565G	probably damaging	Het
Actr3b	G	A	5: 25,829,538	V185I	possibly damaging	Het
Akap6	A	T	12: 53,141,852	E2016D	possibly damaging	Het
Aldh3b2	T	C	19: 3,978,662	V148A	possibly damaging	Het
Ankfy1	C	T	11: 72,754,407	Q771*	probably null	Het
Anks1b	A	G	10: 90,260,756	D425G	probably damaging	Het
Arrb1	T	C	7: 99,582,297		probably benign	Het
Atg2a	C	A	19: 6,245,067	T170N	probably damaging	Het
Atp8b5	C	T	4: 43,361,804	R617C	possibly damaging	Het
Bicra	T	C	7: 15,987,751	T614A	possibly damaging	Het
Cacna1i	A	G	15: 80,391,642	D167G	possibly damaging	Het
Calr4	T	G	4: 109,246,293		probably null	Het
Camsap3	G	T	8: 3,603,922	E515*	probably null	Het
Casp8ap2	T	C	4: 32,643,647	S907P	probably damaging	Het
Cdk19	T	A	10: 40,479,780		probably benign	Het
Chst14	A	G	2: 118,927,015	M122V	possibly damaging	Het
Cntn4	A	G	6: 106,675,813	M748V	probably benign	Het
Col7a1	A	G	9: 108,978,888	D2552G	unknown	Het
Cpeb2	C	A	5: 43,277,587	P600Q	probably damaging	Het
Cyp2a5	C	T	7: 26,839,033	R274*	probably null	Het
Dexi	A	G	16: 10,542,518	F58S	probably damaging	Het
Dlg5	C	A	14: 24,148,300	G1522W	probably damaging	Het
Dock2	T	C	11: 34,294,286	H1048R	probably benign	Het
Dpp4	T	C	2: 62,345,050		probably benign	Het
Dusp10	A	T	1: 184,069,180	K381N	possibly damaging	Het
Ercc4	A	G	16: 13,147,787	E761G	probably damaging	Het
Ern2	T	C	7: 122,183,842		probably benign	Het
Fam83f	A	T	15: 80,692,080	T311S	probably damaging	Het
Fat2	T	C	11: 55,262,178	D3736G	probably benign	Het
Fgf11	G	T	11: 69,801,453	T58K	probably benign	Het
Galntl5	C	G	5: 25,198,532	S167*	probably null	Het
Glg1	T	G	8: 111,165,674	E846D	probably benign	Het
Hmcn1	A	T	1: 150,657,451	D3028E	probably damaging	Het
Htt	A	G	5: 34,907,085	I2943V	probably benign	Het
Ift80	T	C	3: 68,918,513	K498R	probably benign	Het
Ipo9	A	T	1: 135,400,146	M509K	probably damaging	Het
Kcnj3	T	C	2: 55,437,244	V15A	probably damaging	Het
Kcnn3	A	T	3: 89,520,455		probably benign	Het
Larp1b	T	A	3: 40,964,084	D53E	probably benign	Het
Ltf	T	C	9: 111,022,845	F117L	possibly damaging	Het
Maml1	A	G	11: 50,266,130	L406P	probably damaging	Het
Mnx1	G	A	5: 29,473,957	A376V	unknown	Het
Mroh2a	G	A	1: 88,235,376	R376H	probably benign	Het
Mrpl4	A	G	9: 21,006,831	Y111C	probably damaging	Het
Mto1	T	C	9: 78,461,517		probably benign	Het
Nalcn	A	T	14: 123,316,126	M972K	possibly damaging	Het
Nemf	T	C	12: 69,346,378	I225V	probably null	Het
Nipal4	T	G	11: 46,150,231	D379A	probably damaging	Het
Nktr	A	G	9: 121,748,866		probably benign	Het
Nlrp5	A	G	7: 23,404,797	T28A	probably benign	Het
Nxph1	T	A	6: 9,247,622	Y198N	probably damaging	Het
Olfr1037	A	T	2: 86,085,720	V19D	probably benign	Het
Olfr1230	T	C	2: 89,296,670	N200S	probably damaging	Het
Olfr1436	T	C	19: 12,298,343	Y263C	probably damaging	Het
P2rx7	A	G	5: 122,673,736	Y370C	probably benign	Het
Piezo1	T	C	8: 122,482,645		probably benign	Het
Piezo1	T	C	8: 122,489,566	D1401G	probably damaging	Het
Plxnd1	A	G	6: 115,969,363	L879P	probably benign	Het
Polr2a	A	T	11: 69,743,946	I636N	probably damaging	Het
Prex2	G	T	1: 11,162,366	E886*	probably null	Het
Proca1	A	T	11: 78,205,021	I73F	probably damaging	Het
Prss55	A	T	14: 64,079,390	V101E	probably benign	Het
Psg26	T	A	7: 18,478,425	H335L	probably benign	Het
Rai1	A	G	11: 60,185,920	E270G	probably benign	Het
Reep1	A	G	6: 71,780,797	N127D	probably benign	Het
Rims1	G	T	1: 22,428,474	P769Q	probably damaging	Het
Robo4	A	T	9: 37,404,070		probably benign	Het
Ryr2	A	T	13: 11,591,336	D888E	probably benign	Het
Scamp3	A	G	3: 89,180,260	N135D	probably damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sema4f	A	G	6: 82,918,029	M395T	probably benign	Het
Sgip1	T	C	4: 102,968,337		probably null	Het
Sik2	A	T	9: 50,995,674		probably benign	Het
Smtn	G	T	11: 3,531,326	A223D	possibly damaging	Het
Spen	T	C	4: 141,470,343	T3405A	probably benign	Het
Srebf1	A	G	11: 60,203,486	L601P	probably damaging	Het
Srsf11	A	T	3: 158,031,580		probably benign	Het
Tacc2	T	G	7: 130,624,202	S891R	possibly damaging	Het
Tbc1d17	T	A	7: 44,841,633		probably benign	Het
Tgfbr3l	C	A	8: 4,249,600	R128S	probably damaging	Het
Thsd1	G	A	8: 22,252,318		probably benign	Het
Tlx3	T	C	11: 33,203,072	S130G	probably benign	Het
Tmem25	A	T	9: 44,798,216		probably null	Het
Trak2	A	T	1: 58,946,336	M1K	probably null	Het
Trappc12	C	T	12: 28,746,985	E183K	probably damaging	Het
Ubl3	A	G	5: 148,509,280	V71A	possibly damaging	Het
Unc50	A	G	1: 37,438,799	Y254C	probably damaging	Het
Unkl	T	C	17: 25,229,460		probably null	Het
Uso1	T	A	5: 92,201,192	S819T	probably benign	Het
Yes1	A	T	5: 32,645,051	R103S	probably damaging	Het
Zfp131	A	G	13: 119,767,025	V396A	probably damaging	Het
Zfp553	T	C	7: 127,235,654	I127T	possibly damaging	Het
Zfp599	A	T	9: 22,251,549	N102K	probably benign	Het
Zmynd10	A	T	9: 107,550,037	Q288L	probably benign	Het

Other mutations in Grm8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Grm8	APN	6	27363801	missense	probably damaging	1.00
IGL01412:Grm8	APN	6	27762461	missense	probably damaging	1.00
IGL02329:Grm8	APN	6	27363116	missense	probably damaging	1.00
IGL02342:Grm8	APN	6	27363804	missense	probably benign	0.00
IGL02584:Grm8	APN	6	27762439	missense	probably benign	0.35
IGL03040:Grm8	APN	6	28126123	start codon destroyed	probably null	0.01
IGL03112:Grm8	APN	6	27363263	missense	probably damaging	1.00
IGL03139:Grm8	APN	6	27618650	missense	probably damaging	1.00
IGL03287:Grm8	APN	6	27760255	missense	possibly damaging	0.86
R0137:Grm8	UTSW	6	27762390	missense	probably damaging	0.99
R0266:Grm8	UTSW	6	27285896	missense	probably damaging	1.00
R0347:Grm8	UTSW	6	27981222	missense	probably benign	0.37
R0580:Grm8	UTSW	6	27761371	splice site	probably benign
R0698:Grm8	UTSW	6	27363914	missense	probably damaging	1.00
R0833:Grm8	UTSW	6	27363179	missense	probably damaging	1.00
R1301:Grm8	UTSW	6	27981201	missense	possibly damaging	0.94
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1323:Grm8	UTSW	6	28125974	missense	probably damaging	1.00
R1471:Grm8	UTSW	6	27363309	missense	possibly damaging	0.79
R1554:Grm8	UTSW	6	28125853	missense	probably benign	0.01
R1638:Grm8	UTSW	6	28125883	nonsense	probably null
R1763:Grm8	UTSW	6	27285867	missense	possibly damaging	0.79
R1902:Grm8	UTSW	6	27429482	missense	probably damaging	1.00
R1916:Grm8	UTSW	6	27363584	missense	probably benign	0.01
R2257:Grm8	UTSW	6	27760225	missense	probably damaging	0.98
R2351:Grm8	UTSW	6	28126119	missense	possibly damaging	0.66
R2396:Grm8	UTSW	6	27761242	missense	probably damaging	0.98
R3801:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3802:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3803:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3804:Grm8	UTSW	6	28125636	missense	possibly damaging	0.95
R3830:Grm8	UTSW	6	27761229	nonsense	probably null
R3844:Grm8	UTSW	6	27429508	missense	possibly damaging	0.69
R4006:Grm8	UTSW	6	27981230	missense	probably damaging	1.00
R4077:Grm8	UTSW	6	27760209	missense	probably benign	0.01
R4395:Grm8	UTSW	6	27429432	missense	probably damaging	0.98
R4436:Grm8	UTSW	6	27761238	missense	possibly damaging	0.48
R4810:Grm8	UTSW	6	27761296	missense	possibly damaging	0.87
R5357:Grm8	UTSW	6	27762419	missense	probably damaging	1.00
R5677:Grm8	UTSW	6	27761204	critical splice donor site	probably null
R5983:Grm8	UTSW	6	27760221	missense	probably benign	0.03
R5990:Grm8	UTSW	6	27363624	missense	probably damaging	1.00
R6365:Grm8	UTSW	6	27363227	missense	probably damaging	1.00
R6454:Grm8	UTSW	6	27363776	missense	possibly damaging	0.68
R6713:Grm8	UTSW	6	27363191	missense	probably damaging	1.00
R6960:Grm8	UTSW	6	27981282	missense	probably damaging	0.98
R7194:Grm8	UTSW	6	27618487	missense	probably benign	0.01
R7259:Grm8	UTSW	6	27760176	missense	probably null	0.99
R7305:Grm8	UTSW	6	27761355	missense	possibly damaging	0.51
R7421:Grm8	UTSW	6	27762477	missense	possibly damaging	0.66
R7561:Grm8	UTSW	6	27429525	missense	probably benign	0.44
R7605:Grm8	UTSW	6	27618679	missense	probably damaging	1.00
R7651:Grm8	UTSW	6	27760258	missense	possibly damaging	0.46
R7775:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7778:Grm8	UTSW	6	27363672	missense	possibly damaging	0.89
R7781:Grm8	UTSW	6	27285787	missense	probably benign
R7785:Grm8	UTSW	6	27618637	missense	probably damaging	0.99
R7898:Grm8	UTSW	6	27762423	missense	probably damaging	1.00
R8272:Grm8	UTSW	6	27363282	missense	probably damaging	1.00
R8274:Grm8	UTSW	6	27761336	missense	probably benign	0.31
R8501:Grm8	UTSW	6	27618541	missense	probably damaging	0.98
R8695:Grm8	UTSW	6	28126031	missense	probably benign	0.01
R8824:Grm8	UTSW	6	27761352	missense	probably damaging	1.00
R8869:Grm8	UTSW	6	27363753	missense	probably benign	0.26
R9322:Grm8	UTSW	6	27363729	missense	possibly damaging	0.88
R9337:Grm8	UTSW	6	27761215	missense	probably benign	0.01
R9518:Grm8	UTSW	6	27429470	missense	probably benign	0.01
RF013:Grm8	UTSW	6	27363780	missense	probably damaging	1.00
Z1176:Grm8	UTSW	6	28126027	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- GGTCTCCATTAGCACACTTCAC -3'
(R):5'- GGAAAGCGCTCAACCTCTTG -3'

Sequencing Primer
(F):5'- TCCATTAGCACACTTCACGTCAG -3'
(R):5'- TGACTGCCAAGTTCTACTGG -3'

Posted On

2014-07-14