Mutagenetix > Incidental Mutation

Incidental Mutation 'R1899:Plxnd1'

214083

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

MMRRC Submission

039919-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1899 (G1)

Quality Score

193

Status

Validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115969363 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 879 (L879P)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably benign
Transcript: ENSMUST00000015511
AA Change: L879P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: L879P

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000131590
AA Change: L21P

SMART Domains

Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123
AA Change: L21P

Domain	Start	End	E-Value	Type
Blast:PSI	2	34	1e-13	BLAST
IPT	35	124	4.43e-20	SMART
Blast:IPT	125	177	3e-30	BLAST
Pfam:TIG	180	233	4.6e-6	PFAM

Meta Mutation Damage Score

0.0609

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.4%

Validation Efficiency

94% (94/100)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,258,342	W378R	probably benign	Het
4930522L14Rik	T	A	5: 109,736,798	Q398L	probably benign	Het
4930596D02Rik	T	G	14: 35,810,132	K162T	probably damaging	Het
Abca8b	G	T	11: 109,937,918	T1353K	possibly damaging	Het
Abcg3	A	C	5: 104,938,199	C565G	probably damaging	Het
Actr3b	G	A	5: 25,829,538	V185I	possibly damaging	Het
Akap6	A	T	12: 53,141,852	E2016D	possibly damaging	Het
Aldh3b2	T	C	19: 3,978,662	V148A	possibly damaging	Het
Ankfy1	C	T	11: 72,754,407	Q771*	probably null	Het
Anks1b	A	G	10: 90,260,756	D425G	probably damaging	Het
Arrb1	T	C	7: 99,582,297		probably benign	Het
Atg2a	C	A	19: 6,245,067	T170N	probably damaging	Het
Atp8b5	C	T	4: 43,361,804	R617C	possibly damaging	Het
Bicra	T	C	7: 15,987,751	T614A	possibly damaging	Het
Cacna1i	A	G	15: 80,391,642	D167G	possibly damaging	Het
Calr4	T	G	4: 109,246,293		probably null	Het
Camsap3	G	T	8: 3,603,922	E515*	probably null	Het
Casp8ap2	T	C	4: 32,643,647	S907P	probably damaging	Het
Cdk19	T	A	10: 40,479,780		probably benign	Het
Chst14	A	G	2: 118,927,015	M122V	possibly damaging	Het
Cntn4	A	G	6: 106,675,813	M748V	probably benign	Het
Col7a1	A	G	9: 108,978,888	D2552G	unknown	Het
Cpeb2	C	A	5: 43,277,587	P600Q	probably damaging	Het
Cyp2a5	C	T	7: 26,839,033	R274*	probably null	Het
Dexi	A	G	16: 10,542,518	F58S	probably damaging	Het
Dlg5	C	A	14: 24,148,300	G1522W	probably damaging	Het
Dock2	T	C	11: 34,294,286	H1048R	probably benign	Het
Dpp4	T	C	2: 62,345,050		probably benign	Het
Dusp10	A	T	1: 184,069,180	K381N	possibly damaging	Het
Ercc4	A	G	16: 13,147,787	E761G	probably damaging	Het
Ern2	T	C	7: 122,183,842		probably benign	Het
Fam83f	A	T	15: 80,692,080	T311S	probably damaging	Het
Fat2	T	C	11: 55,262,178	D3736G	probably benign	Het
Fgf11	G	T	11: 69,801,453	T58K	probably benign	Het
Galntl5	C	G	5: 25,198,532	S167*	probably null	Het
Glg1	T	G	8: 111,165,674	E846D	probably benign	Het
Grm8	C	A	6: 28,125,895	E77D	probably damaging	Het
Hmcn1	A	T	1: 150,657,451	D3028E	probably damaging	Het
Htt	A	G	5: 34,907,085	I2943V	probably benign	Het
Ift80	T	C	3: 68,918,513	K498R	probably benign	Het
Ipo9	A	T	1: 135,400,146	M509K	probably damaging	Het
Kcnj3	T	C	2: 55,437,244	V15A	probably damaging	Het
Kcnn3	A	T	3: 89,520,455		probably benign	Het
Larp1b	T	A	3: 40,964,084	D53E	probably benign	Het
Ltf	T	C	9: 111,022,845	F117L	possibly damaging	Het
Maml1	A	G	11: 50,266,130	L406P	probably damaging	Het
Mnx1	G	A	5: 29,473,957	A376V	unknown	Het
Mroh2a	G	A	1: 88,235,376	R376H	probably benign	Het
Mrpl4	A	G	9: 21,006,831	Y111C	probably damaging	Het
Mto1	T	C	9: 78,461,517		probably benign	Het
Nalcn	A	T	14: 123,316,126	M972K	possibly damaging	Het
Nemf	T	C	12: 69,346,378	I225V	probably null	Het
Nipal4	T	G	11: 46,150,231	D379A	probably damaging	Het
Nktr	A	G	9: 121,748,866		probably benign	Het
Nlrp5	A	G	7: 23,404,797	T28A	probably benign	Het
Nxph1	T	A	6: 9,247,622	Y198N	probably damaging	Het
Olfr1037	A	T	2: 86,085,720	V19D	probably benign	Het
Olfr1230	T	C	2: 89,296,670	N200S	probably damaging	Het
Olfr1436	T	C	19: 12,298,343	Y263C	probably damaging	Het
P2rx7	A	G	5: 122,673,736	Y370C	probably benign	Het
Piezo1	T	C	8: 122,482,645		probably benign	Het
Piezo1	T	C	8: 122,489,566	D1401G	probably damaging	Het
Polr2a	A	T	11: 69,743,946	I636N	probably damaging	Het
Prex2	G	T	1: 11,162,366	E886*	probably null	Het
Proca1	A	T	11: 78,205,021	I73F	probably damaging	Het
Prss55	A	T	14: 64,079,390	V101E	probably benign	Het
Psg26	T	A	7: 18,478,425	H335L	probably benign	Het
Rai1	A	G	11: 60,185,920	E270G	probably benign	Het
Reep1	A	G	6: 71,780,797	N127D	probably benign	Het
Rims1	G	T	1: 22,428,474	P769Q	probably damaging	Het
Robo4	A	T	9: 37,404,070		probably benign	Het
Ryr2	A	T	13: 11,591,336	D888E	probably benign	Het
Scamp3	A	G	3: 89,180,260	N135D	probably damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sema4f	A	G	6: 82,918,029	M395T	probably benign	Het
Sgip1	T	C	4: 102,968,337		probably null	Het
Sik2	A	T	9: 50,995,674		probably benign	Het
Smtn	G	T	11: 3,531,326	A223D	possibly damaging	Het
Spen	T	C	4: 141,470,343	T3405A	probably benign	Het
Srebf1	A	G	11: 60,203,486	L601P	probably damaging	Het
Srsf11	A	T	3: 158,031,580		probably benign	Het
Tacc2	T	G	7: 130,624,202	S891R	possibly damaging	Het
Tbc1d17	T	A	7: 44,841,633		probably benign	Het
Tgfbr3l	C	A	8: 4,249,600	R128S	probably damaging	Het
Thsd1	G	A	8: 22,252,318		probably benign	Het
Tlx3	T	C	11: 33,203,072	S130G	probably benign	Het
Tmem25	A	T	9: 44,798,216		probably null	Het
Trak2	A	T	1: 58,946,336	M1K	probably null	Het
Trappc12	C	T	12: 28,746,985	E183K	probably damaging	Het
Ubl3	A	G	5: 148,509,280	V71A	possibly damaging	Het
Unc50	A	G	1: 37,438,799	Y254C	probably damaging	Het
Unkl	T	C	17: 25,229,460		probably null	Het
Uso1	T	A	5: 92,201,192	S819T	probably benign	Het
Yes1	A	T	5: 32,645,051	R103S	probably damaging	Het
Zfp131	A	G	13: 119,767,025	V396A	probably damaging	Het
Zfp553	T	C	7: 127,235,654	I127T	possibly damaging	Het
Zfp599	A	T	9: 22,251,549	N102K	probably benign	Het
Zmynd10	A	T	9: 107,550,037	Q288L	probably benign	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115967972	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115969945	missense	probably benign
IGL01323:Plxnd1	APN	6	115966799	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115960527	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115959935	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115978257	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115993628	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115963913	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115955742	makesense	probably null
IGL02873:Plxnd1	APN	6	115959976	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115962357	missense	probably damaging	1.00
Hiss	UTSW	6	115969929	missense	possibly damaging	0.94
murmer	UTSW	6	115968793	missense	probably benign	0.00
mutter	UTSW	6	115968044	missense	probably benign	0.27
rattle	UTSW	6	115959794	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115969460	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115958699	splice site	probably benign
R0648:Plxnd1	UTSW	6	115994001	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115966638	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115967005	splice site	probably null
R1292:Plxnd1	UTSW	6	115962683	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115968681	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115967779	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115994057	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115980601	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115966546	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115963914	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115969441	splice site	probably null
R1865:Plxnd1	UTSW	6	115969441	splice site	probably null
R1875:Plxnd1	UTSW	6	115978084	splice site	probably null
R1913:Plxnd1	UTSW	6	115978017	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115962517	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115967255	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115957548	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115962764	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115964144	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115962743	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115967748	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115959315	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115965953	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115956094	splice site	probably benign
R4280:Plxnd1	UTSW	6	115956095	splice site	probably null
R4346:Plxnd1	UTSW	6	115977980	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115993976	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115955756	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115968044	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115994276	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115972525	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115958615	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115958620	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115960855	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115955765	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115994376	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115965901	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115958988	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115957648	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115965877	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115968688	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115967787	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115978174	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115977960	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115978492	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115976736	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115969929	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115993763	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115972507	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115960837	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115976639	missense	probably benign
R7699:Plxnd1	UTSW	6	115959794	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115966918	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115956617	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115972472	missense	probably benign
R8507:Plxnd1	UTSW	6	115966905	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115962807	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115957597	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115972545	nonsense	probably null
R9119:Plxnd1	UTSW	6	115955871	splice site	probably benign
R9177:Plxnd1	UTSW	6	115966508	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115993785	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115957565	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115957563	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115955769	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115963316	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115963313	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115963310	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115966784	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115967510	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GAAATCCTCAACTGTCACCCGG -3'
(R):5'- TGAACCTTATGGCTGCCAAC -3'

Sequencing Primer
(F):5'- TCAACTGTCACCCGGTCAGAG -3'
(R):5'- TTATGGCTGCCAACCCCAGAG -3'

Posted On

2014-07-14