Incidental Mutation 'R1899:Cyp2a5'
ID 214087
Institutional Source Beutler Lab
Gene Symbol Cyp2a5
Ensembl Gene ENSMUSG00000005547
Gene Name cytochrome P450, family 2, subfamily a, polypeptide 5
Synonyms Coh
MMRRC Submission 039919-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R1899 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 26534764-26542689 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 26538458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 274 (R274*)
Ref Sequence ENSEMBL: ENSMUSP00000005685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005685] [ENSMUST00000168869] [ENSMUST00000169007]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000005685
AA Change: R274*
SMART Domains Protein: ENSMUSP00000005685
Gene: ENSMUSG00000005547
AA Change: R274*

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 34 491 4e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165641
Predicted Effect probably benign
Transcript: ENSMUST00000168869
SMART Domains Protein: ENSMUSP00000130640
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
PDB:2PG7|D 25 60 9e-14 PDB
SCOP:d1jpza_ 30 60 6e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169007
SMART Domains Protein: ENSMUSP00000128865
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
Pfam:p450 1 116 1.1e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170631
SMART Domains Protein: ENSMUSP00000127829
Gene: ENSMUSG00000005547

DomainStartEndE-ValueType
Pfam:p450 1 59 2.9e-20 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype PHENOTYPE: Mice exhibit strain-specific cytochrome activity levels. Mice homozygous for a knock-out allele exhibit slower clearance of nicotine and cotinine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,884,664 (GRCm39) Q398L probably benign Het
4930596D02Rik T G 14: 35,532,089 (GRCm39) K162T probably damaging Het
Abca8b G T 11: 109,828,744 (GRCm39) T1353K possibly damaging Het
Abcg3 A C 5: 105,086,065 (GRCm39) C565G probably damaging Het
Actr3b G A 5: 26,034,536 (GRCm39) V185I possibly damaging Het
Akap6 A T 12: 53,188,635 (GRCm39) E2016D possibly damaging Het
Aldh3b2 T C 19: 4,028,662 (GRCm39) V148A possibly damaging Het
Ankfy1 C T 11: 72,645,233 (GRCm39) Q771* probably null Het
Anks1b A G 10: 90,096,618 (GRCm39) D425G probably damaging Het
Arrb1 T C 7: 99,231,504 (GRCm39) probably benign Het
Atg2a C A 19: 6,295,097 (GRCm39) T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 (GRCm39) R617C possibly damaging Het
Bicra T C 7: 15,721,676 (GRCm39) T614A possibly damaging Het
Cacna1i A G 15: 80,275,843 (GRCm39) D167G possibly damaging Het
Calr4 T G 4: 109,103,490 (GRCm39) probably null Het
Camsap3 G T 8: 3,653,922 (GRCm39) E515* probably null Het
Casp8ap2 T C 4: 32,643,647 (GRCm39) S907P probably damaging Het
Cdk19 T A 10: 40,355,776 (GRCm39) probably benign Het
Chst14 A G 2: 118,757,496 (GRCm39) M122V possibly damaging Het
Cntn4 A G 6: 106,652,774 (GRCm39) M748V probably benign Het
Col7a1 A G 9: 108,807,956 (GRCm39) D2552G unknown Het
Cpeb2 C A 5: 43,434,930 (GRCm39) P600Q probably damaging Het
Dele1 T C 18: 38,391,395 (GRCm39) W378R probably benign Het
Dexi A G 16: 10,360,382 (GRCm39) F58S probably damaging Het
Dlg5 C A 14: 24,198,368 (GRCm39) G1522W probably damaging Het
Dock2 T C 11: 34,244,286 (GRCm39) H1048R probably benign Het
Dpp4 T C 2: 62,175,394 (GRCm39) probably benign Het
Dusp10 A T 1: 183,801,377 (GRCm39) K381N possibly damaging Het
Ercc4 A G 16: 12,965,651 (GRCm39) E761G probably damaging Het
Ern2 T C 7: 121,783,065 (GRCm39) probably benign Het
Fam83f A T 15: 80,576,281 (GRCm39) T311S probably damaging Het
Fat2 T C 11: 55,153,004 (GRCm39) D3736G probably benign Het
Fgf11 G T 11: 69,692,279 (GRCm39) T58K probably benign Het
Galntl5 C G 5: 25,403,530 (GRCm39) S167* probably null Het
Glg1 T G 8: 111,892,306 (GRCm39) E846D probably benign Het
Grm8 C A 6: 28,125,894 (GRCm39) E77D probably damaging Het
Hmcn1 A T 1: 150,533,202 (GRCm39) D3028E probably damaging Het
Htt A G 5: 35,064,429 (GRCm39) I2943V probably benign Het
Ift80 T C 3: 68,825,846 (GRCm39) K498R probably benign Het
Ipo9 A T 1: 135,327,884 (GRCm39) M509K probably damaging Het
Kcnj3 T C 2: 55,327,256 (GRCm39) V15A probably damaging Het
Kcnn3 A T 3: 89,427,762 (GRCm39) probably benign Het
Larp1b T A 3: 40,918,519 (GRCm39) D53E probably benign Het
Ltf T C 9: 110,851,913 (GRCm39) F117L possibly damaging Het
Maml1 A G 11: 50,156,957 (GRCm39) L406P probably damaging Het
Mnx1 G A 5: 29,678,955 (GRCm39) A376V unknown Het
Mroh2a G A 1: 88,163,098 (GRCm39) R376H probably benign Het
Mrpl4 A G 9: 20,918,127 (GRCm39) Y111C probably damaging Het
Mto1 T C 9: 78,368,799 (GRCm39) probably benign Het
Nalcn A T 14: 123,553,538 (GRCm39) M972K possibly damaging Het
Nemf T C 12: 69,393,152 (GRCm39) I225V probably null Het
Nipal4 T G 11: 46,041,058 (GRCm39) D379A probably damaging Het
Nktr A G 9: 121,577,932 (GRCm39) probably benign Het
Nlrp5 A G 7: 23,104,222 (GRCm39) T28A probably benign Het
Nxph1 T A 6: 9,247,622 (GRCm39) Y198N probably damaging Het
Or4c123 T C 2: 89,127,014 (GRCm39) N200S probably damaging Het
Or5an10 T C 19: 12,275,707 (GRCm39) Y263C probably damaging Het
Or8u10 A T 2: 85,916,064 (GRCm39) V19D probably benign Het
P2rx7 A G 5: 122,811,799 (GRCm39) Y370C probably benign Het
Piezo1 T C 8: 123,209,384 (GRCm39) probably benign Het
Piezo1 T C 8: 123,216,305 (GRCm39) D1401G probably damaging Het
Plxnd1 A G 6: 115,946,324 (GRCm39) L879P probably benign Het
Polr2a A T 11: 69,634,772 (GRCm39) I636N probably damaging Het
Prex2 G T 1: 11,232,590 (GRCm39) E886* probably null Het
Proca1 A T 11: 78,095,847 (GRCm39) I73F probably damaging Het
Prss55 A T 14: 64,316,839 (GRCm39) V101E probably benign Het
Psg26 T A 7: 18,212,350 (GRCm39) H335L probably benign Het
Rai1 A G 11: 60,076,746 (GRCm39) E270G probably benign Het
Reep1 A G 6: 71,757,781 (GRCm39) N127D probably benign Het
Rims1 G T 1: 22,498,725 (GRCm39) P769Q probably damaging Het
Robo4 A T 9: 37,315,366 (GRCm39) probably benign Het
Ryr2 A T 13: 11,606,222 (GRCm39) D888E probably benign Het
Scamp3 A G 3: 89,087,567 (GRCm39) N135D probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sema4f A G 6: 82,895,010 (GRCm39) M395T probably benign Het
Sgip1 T C 4: 102,825,534 (GRCm39) probably null Het
Sik2 A T 9: 50,906,974 (GRCm39) probably benign Het
Smtn G T 11: 3,481,326 (GRCm39) A223D possibly damaging Het
Spen T C 4: 141,197,654 (GRCm39) T3405A probably benign Het
Srebf1 A G 11: 60,094,312 (GRCm39) L601P probably damaging Het
Srsf11 A T 3: 157,737,217 (GRCm39) probably benign Het
Tacc2 T G 7: 130,225,932 (GRCm39) S891R possibly damaging Het
Tbc1d17 T A 7: 44,491,057 (GRCm39) probably benign Het
Tgfbr3l C A 8: 4,299,600 (GRCm39) R128S probably damaging Het
Thsd1 G A 8: 22,742,334 (GRCm39) probably benign Het
Tlx3 T C 11: 33,153,072 (GRCm39) S130G probably benign Het
Tmem25 A T 9: 44,709,513 (GRCm39) probably null Het
Trak2 A T 1: 58,985,495 (GRCm39) M1K probably null Het
Trappc12 C T 12: 28,796,984 (GRCm39) E183K probably damaging Het
Ubl3 A G 5: 148,446,090 (GRCm39) V71A possibly damaging Het
Unc50 A G 1: 37,477,880 (GRCm39) Y254C probably damaging Het
Unkl T C 17: 25,448,434 (GRCm39) probably null Het
Uso1 T A 5: 92,349,051 (GRCm39) S819T probably benign Het
Yes1 A T 5: 32,802,395 (GRCm39) R103S probably damaging Het
Zfp131 A G 13: 120,228,561 (GRCm39) V396A probably damaging Het
Zfp553 T C 7: 126,834,826 (GRCm39) I127T possibly damaging Het
Zfp599 A T 9: 22,162,845 (GRCm39) N102K probably benign Het
Zmynd10 A T 9: 107,427,236 (GRCm39) Q288L probably benign Het
Other mutations in Cyp2a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Cyp2a5 APN 7 26,536,528 (GRCm39) missense possibly damaging 0.82
IGL01744:Cyp2a5 APN 7 26,540,434 (GRCm39) missense probably damaging 1.00
IGL02155:Cyp2a5 APN 7 26,542,471 (GRCm39) missense probably benign 0.06
IGL03076:Cyp2a5 APN 7 26,535,299 (GRCm39) missense probably damaging 0.99
PIT4696001:Cyp2a5 UTSW 7 26,540,404 (GRCm39) missense probably benign 0.18
R0762:Cyp2a5 UTSW 7 26,538,298 (GRCm39) nonsense probably null
R0980:Cyp2a5 UTSW 7 26,538,431 (GRCm39) splice site probably null
R1078:Cyp2a5 UTSW 7 26,534,966 (GRCm39) missense probably benign 0.33
R1511:Cyp2a5 UTSW 7 26,535,361 (GRCm39) missense probably damaging 1.00
R1780:Cyp2a5 UTSW 7 26,541,301 (GRCm39) intron probably benign
R1803:Cyp2a5 UTSW 7 26,534,971 (GRCm39) splice site probably null
R1977:Cyp2a5 UTSW 7 26,535,347 (GRCm39) missense probably benign 0.15
R2215:Cyp2a5 UTSW 7 26,539,900 (GRCm39) missense probably damaging 1.00
R2258:Cyp2a5 UTSW 7 26,536,528 (GRCm39) missense possibly damaging 0.82
R3051:Cyp2a5 UTSW 7 26,542,410 (GRCm39) missense possibly damaging 0.77
R3052:Cyp2a5 UTSW 7 26,542,410 (GRCm39) missense possibly damaging 0.77
R3053:Cyp2a5 UTSW 7 26,542,410 (GRCm39) missense possibly damaging 0.77
R4387:Cyp2a5 UTSW 7 26,540,479 (GRCm39) missense probably damaging 0.97
R4832:Cyp2a5 UTSW 7 26,534,970 (GRCm39) critical splice donor site probably null
R5054:Cyp2a5 UTSW 7 26,540,529 (GRCm39) missense probably damaging 1.00
R5622:Cyp2a5 UTSW 7 26,535,299 (GRCm39) missense probably damaging 1.00
R5867:Cyp2a5 UTSW 7 26,542,383 (GRCm39) missense probably benign 0.09
R5998:Cyp2a5 UTSW 7 26,536,578 (GRCm39) missense probably benign 0.00
R6186:Cyp2a5 UTSW 7 26,542,813 (GRCm39) unclassified probably benign
R7338:Cyp2a5 UTSW 7 26,542,372 (GRCm39) missense probably damaging 1.00
R7350:Cyp2a5 UTSW 7 26,536,208 (GRCm39) missense probably benign 0.37
R7536:Cyp2a5 UTSW 7 26,539,903 (GRCm39) missense probably damaging 1.00
R7722:Cyp2a5 UTSW 7 26,536,543 (GRCm39) missense probably benign 0.31
R7831:Cyp2a5 UTSW 7 26,534,940 (GRCm39) missense possibly damaging 0.71
R7983:Cyp2a5 UTSW 7 26,539,866 (GRCm39) missense probably benign 0.40
R8805:Cyp2a5 UTSW 7 26,540,530 (GRCm39) missense probably damaging 0.99
R9378:Cyp2a5 UTSW 7 26,539,879 (GRCm39) missense probably damaging 1.00
R9481:Cyp2a5 UTSW 7 26,540,511 (GRCm39) missense possibly damaging 0.95
R9620:Cyp2a5 UTSW 7 26,536,636 (GRCm39) missense possibly damaging 0.75
Z1088:Cyp2a5 UTSW 7 26,540,532 (GRCm39) missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26,536,199 (GRCm39) missense probably damaging 1.00
Z1176:Cyp2a5 UTSW 7 26,534,922 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATTTTGTGCCGACAGCTTC -3'
(R):5'- TATCCTCCTGAGACTGAGCAG -3'

Sequencing Primer
(F):5'- GCCGACAGCTTCCTTGATTTTTC -3'
(R):5'- TCCTGAGACTGAGCAGTGGAC -3'
Posted On 2014-07-14