Incidental Mutation 'R1899:Camsap3'
ID 214093
Institutional Source Beutler Lab
Gene Symbol Camsap3
Ensembl Gene ENSMUSG00000044433
Gene Name calmodulin regulated spectrin-associated protein family, member 3
Synonyms Nezha, 2310057J16Rik
MMRRC Submission 039919-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R1899 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 3637293-3659075 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 3653922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 515 (E515*)
Ref Sequence ENSEMBL: ENSMUSP00000146772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057028] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208240] [ENSMUST00000208036]
AlphaFold Q80VC9
Predicted Effect probably null
Transcript: ENSMUST00000057028
AA Change: E504*
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433
AA Change: E504*

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect probably null
Transcript: ENSMUST00000171962
AA Change: E505*
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433
AA Change: E505*

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably null
Transcript: ENSMUST00000207077
AA Change: E520*
Predicted Effect probably benign
Transcript: ENSMUST00000207152
Predicted Effect probably null
Transcript: ENSMUST00000207432
AA Change: E531*
Predicted Effect probably benign
Transcript: ENSMUST00000207533
Predicted Effect probably benign
Transcript: ENSMUST00000207712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207930
Predicted Effect probably null
Transcript: ENSMUST00000207970
AA Change: E515*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208064
Predicted Effect probably benign
Transcript: ENSMUST00000208240
Predicted Effect probably benign
Transcript: ENSMUST00000208036
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display variable penetrance of vascular, liver, nervous system, rib and eye abnormalities. Mice homozygous for an allele with loss of microtubule binding show partial lethality, decreased body size and abnormal alignment of microtubles in polarized epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,884,664 (GRCm39) Q398L probably benign Het
4930596D02Rik T G 14: 35,532,089 (GRCm39) K162T probably damaging Het
Abca8b G T 11: 109,828,744 (GRCm39) T1353K possibly damaging Het
Abcg3 A C 5: 105,086,065 (GRCm39) C565G probably damaging Het
Actr3b G A 5: 26,034,536 (GRCm39) V185I possibly damaging Het
Akap6 A T 12: 53,188,635 (GRCm39) E2016D possibly damaging Het
Aldh3b2 T C 19: 4,028,662 (GRCm39) V148A possibly damaging Het
Ankfy1 C T 11: 72,645,233 (GRCm39) Q771* probably null Het
Anks1b A G 10: 90,096,618 (GRCm39) D425G probably damaging Het
Arrb1 T C 7: 99,231,504 (GRCm39) probably benign Het
Atg2a C A 19: 6,295,097 (GRCm39) T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 (GRCm39) R617C possibly damaging Het
Bicra T C 7: 15,721,676 (GRCm39) T614A possibly damaging Het
Cacna1i A G 15: 80,275,843 (GRCm39) D167G possibly damaging Het
Calr4 T G 4: 109,103,490 (GRCm39) probably null Het
Casp8ap2 T C 4: 32,643,647 (GRCm39) S907P probably damaging Het
Cdk19 T A 10: 40,355,776 (GRCm39) probably benign Het
Chst14 A G 2: 118,757,496 (GRCm39) M122V possibly damaging Het
Cntn4 A G 6: 106,652,774 (GRCm39) M748V probably benign Het
Col7a1 A G 9: 108,807,956 (GRCm39) D2552G unknown Het
Cpeb2 C A 5: 43,434,930 (GRCm39) P600Q probably damaging Het
Cyp2a5 C T 7: 26,538,458 (GRCm39) R274* probably null Het
Dele1 T C 18: 38,391,395 (GRCm39) W378R probably benign Het
Dexi A G 16: 10,360,382 (GRCm39) F58S probably damaging Het
Dlg5 C A 14: 24,198,368 (GRCm39) G1522W probably damaging Het
Dock2 T C 11: 34,244,286 (GRCm39) H1048R probably benign Het
Dpp4 T C 2: 62,175,394 (GRCm39) probably benign Het
Dusp10 A T 1: 183,801,377 (GRCm39) K381N possibly damaging Het
Ercc4 A G 16: 12,965,651 (GRCm39) E761G probably damaging Het
Ern2 T C 7: 121,783,065 (GRCm39) probably benign Het
Fam83f A T 15: 80,576,281 (GRCm39) T311S probably damaging Het
Fat2 T C 11: 55,153,004 (GRCm39) D3736G probably benign Het
Fgf11 G T 11: 69,692,279 (GRCm39) T58K probably benign Het
Galntl5 C G 5: 25,403,530 (GRCm39) S167* probably null Het
Glg1 T G 8: 111,892,306 (GRCm39) E846D probably benign Het
Grm8 C A 6: 28,125,894 (GRCm39) E77D probably damaging Het
Hmcn1 A T 1: 150,533,202 (GRCm39) D3028E probably damaging Het
Htt A G 5: 35,064,429 (GRCm39) I2943V probably benign Het
Ift80 T C 3: 68,825,846 (GRCm39) K498R probably benign Het
Ipo9 A T 1: 135,327,884 (GRCm39) M509K probably damaging Het
Kcnj3 T C 2: 55,327,256 (GRCm39) V15A probably damaging Het
Kcnn3 A T 3: 89,427,762 (GRCm39) probably benign Het
Larp1b T A 3: 40,918,519 (GRCm39) D53E probably benign Het
Ltf T C 9: 110,851,913 (GRCm39) F117L possibly damaging Het
Maml1 A G 11: 50,156,957 (GRCm39) L406P probably damaging Het
Mnx1 G A 5: 29,678,955 (GRCm39) A376V unknown Het
Mroh2a G A 1: 88,163,098 (GRCm39) R376H probably benign Het
Mrpl4 A G 9: 20,918,127 (GRCm39) Y111C probably damaging Het
Mto1 T C 9: 78,368,799 (GRCm39) probably benign Het
Nalcn A T 14: 123,553,538 (GRCm39) M972K possibly damaging Het
Nemf T C 12: 69,393,152 (GRCm39) I225V probably null Het
Nipal4 T G 11: 46,041,058 (GRCm39) D379A probably damaging Het
Nktr A G 9: 121,577,932 (GRCm39) probably benign Het
Nlrp5 A G 7: 23,104,222 (GRCm39) T28A probably benign Het
Nxph1 T A 6: 9,247,622 (GRCm39) Y198N probably damaging Het
Or4c123 T C 2: 89,127,014 (GRCm39) N200S probably damaging Het
Or5an10 T C 19: 12,275,707 (GRCm39) Y263C probably damaging Het
Or8u10 A T 2: 85,916,064 (GRCm39) V19D probably benign Het
P2rx7 A G 5: 122,811,799 (GRCm39) Y370C probably benign Het
Piezo1 T C 8: 123,209,384 (GRCm39) probably benign Het
Piezo1 T C 8: 123,216,305 (GRCm39) D1401G probably damaging Het
Plxnd1 A G 6: 115,946,324 (GRCm39) L879P probably benign Het
Polr2a A T 11: 69,634,772 (GRCm39) I636N probably damaging Het
Prex2 G T 1: 11,232,590 (GRCm39) E886* probably null Het
Proca1 A T 11: 78,095,847 (GRCm39) I73F probably damaging Het
Prss55 A T 14: 64,316,839 (GRCm39) V101E probably benign Het
Psg26 T A 7: 18,212,350 (GRCm39) H335L probably benign Het
Rai1 A G 11: 60,076,746 (GRCm39) E270G probably benign Het
Reep1 A G 6: 71,757,781 (GRCm39) N127D probably benign Het
Rims1 G T 1: 22,498,725 (GRCm39) P769Q probably damaging Het
Robo4 A T 9: 37,315,366 (GRCm39) probably benign Het
Ryr2 A T 13: 11,606,222 (GRCm39) D888E probably benign Het
Scamp3 A G 3: 89,087,567 (GRCm39) N135D probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sema4f A G 6: 82,895,010 (GRCm39) M395T probably benign Het
Sgip1 T C 4: 102,825,534 (GRCm39) probably null Het
Sik2 A T 9: 50,906,974 (GRCm39) probably benign Het
Smtn G T 11: 3,481,326 (GRCm39) A223D possibly damaging Het
Spen T C 4: 141,197,654 (GRCm39) T3405A probably benign Het
Srebf1 A G 11: 60,094,312 (GRCm39) L601P probably damaging Het
Srsf11 A T 3: 157,737,217 (GRCm39) probably benign Het
Tacc2 T G 7: 130,225,932 (GRCm39) S891R possibly damaging Het
Tbc1d17 T A 7: 44,491,057 (GRCm39) probably benign Het
Tgfbr3l C A 8: 4,299,600 (GRCm39) R128S probably damaging Het
Thsd1 G A 8: 22,742,334 (GRCm39) probably benign Het
Tlx3 T C 11: 33,153,072 (GRCm39) S130G probably benign Het
Tmem25 A T 9: 44,709,513 (GRCm39) probably null Het
Trak2 A T 1: 58,985,495 (GRCm39) M1K probably null Het
Trappc12 C T 12: 28,796,984 (GRCm39) E183K probably damaging Het
Ubl3 A G 5: 148,446,090 (GRCm39) V71A possibly damaging Het
Unc50 A G 1: 37,477,880 (GRCm39) Y254C probably damaging Het
Unkl T C 17: 25,448,434 (GRCm39) probably null Het
Uso1 T A 5: 92,349,051 (GRCm39) S819T probably benign Het
Yes1 A T 5: 32,802,395 (GRCm39) R103S probably damaging Het
Zfp131 A G 13: 120,228,561 (GRCm39) V396A probably damaging Het
Zfp553 T C 7: 126,834,826 (GRCm39) I127T possibly damaging Het
Zfp599 A T 9: 22,162,845 (GRCm39) N102K probably benign Het
Zmynd10 A T 9: 107,427,236 (GRCm39) Q288L probably benign Het
Other mutations in Camsap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Camsap3 APN 8 3,652,077 (GRCm39) missense probably damaging 1.00
IGL00797:Camsap3 APN 8 3,652,115 (GRCm39) splice site probably benign
IGL01457:Camsap3 APN 8 3,654,795 (GRCm39) missense probably damaging 0.98
IGL01833:Camsap3 APN 8 3,658,508 (GRCm39) missense probably damaging 1.00
IGL02095:Camsap3 APN 8 3,653,845 (GRCm39) missense probably damaging 1.00
IGL02880:Camsap3 APN 8 3,653,913 (GRCm39) missense probably damaging 1.00
R0005:Camsap3 UTSW 8 3,654,288 (GRCm39) missense probably damaging 1.00
R0049:Camsap3 UTSW 8 3,648,772 (GRCm39) missense probably benign 0.11
R0049:Camsap3 UTSW 8 3,648,772 (GRCm39) missense probably benign 0.11
R0347:Camsap3 UTSW 8 3,652,029 (GRCm39) missense probably damaging 1.00
R0926:Camsap3 UTSW 8 3,637,960 (GRCm39) critical splice donor site probably null
R0946:Camsap3 UTSW 8 3,654,442 (GRCm39) missense probably benign 0.00
R1169:Camsap3 UTSW 8 3,653,866 (GRCm39) missense probably damaging 1.00
R1206:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1454:Camsap3 UTSW 8 3,653,968 (GRCm39) missense possibly damaging 0.58
R1475:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1581:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1618:Camsap3 UTSW 8 3,648,740 (GRCm39) missense probably benign 0.25
R1820:Camsap3 UTSW 8 3,653,485 (GRCm39) missense probably damaging 1.00
R1914:Camsap3 UTSW 8 3,654,708 (GRCm39) missense probably damaging 1.00
R1952:Camsap3 UTSW 8 3,654,789 (GRCm39) missense probably damaging 0.99
R2338:Camsap3 UTSW 8 3,656,808 (GRCm39) missense probably damaging 1.00
R3725:Camsap3 UTSW 8 3,653,785 (GRCm39) missense probably damaging 1.00
R3726:Camsap3 UTSW 8 3,653,785 (GRCm39) missense probably damaging 1.00
R4528:Camsap3 UTSW 8 3,656,515 (GRCm39) missense possibly damaging 0.79
R4652:Camsap3 UTSW 8 3,650,689 (GRCm39) missense possibly damaging 0.87
R5025:Camsap3 UTSW 8 3,654,244 (GRCm39) missense probably damaging 1.00
R5120:Camsap3 UTSW 8 3,650,680 (GRCm39) missense probably damaging 0.97
R5381:Camsap3 UTSW 8 3,653,812 (GRCm39) missense probably damaging 1.00
R5388:Camsap3 UTSW 8 3,654,276 (GRCm39) missense probably damaging 1.00
R5829:Camsap3 UTSW 8 3,647,899 (GRCm39) missense probably damaging 1.00
R5846:Camsap3 UTSW 8 3,653,980 (GRCm39) missense probably damaging 1.00
R5935:Camsap3 UTSW 8 3,651,999 (GRCm39) missense probably damaging 1.00
R6363:Camsap3 UTSW 8 3,651,971 (GRCm39) missense probably damaging 1.00
R6469:Camsap3 UTSW 8 3,653,941 (GRCm39) missense possibly damaging 0.79
R6595:Camsap3 UTSW 8 3,658,742 (GRCm39) missense probably damaging 1.00
R6595:Camsap3 UTSW 8 3,654,186 (GRCm39) missense probably damaging 1.00
R7024:Camsap3 UTSW 8 3,658,242 (GRCm39) missense probably damaging 0.98
R7062:Camsap3 UTSW 8 3,657,834 (GRCm39) unclassified probably benign
R7109:Camsap3 UTSW 8 3,648,087 (GRCm39) missense possibly damaging 0.53
R7233:Camsap3 UTSW 8 3,650,371 (GRCm39) missense probably damaging 0.99
R7236:Camsap3 UTSW 8 3,654,116 (GRCm39) missense probably damaging 1.00
R7316:Camsap3 UTSW 8 3,654,648 (GRCm39) missense possibly damaging 0.51
R7340:Camsap3 UTSW 8 3,637,960 (GRCm39) critical splice donor site probably null
R7512:Camsap3 UTSW 8 3,648,740 (GRCm39) missense probably benign 0.25
R7779:Camsap3 UTSW 8 3,647,887 (GRCm39) missense probably damaging 1.00
R8134:Camsap3 UTSW 8 3,648,075 (GRCm39) missense probably benign 0.00
R8356:Camsap3 UTSW 8 3,650,679 (GRCm39) nonsense probably null
R8456:Camsap3 UTSW 8 3,650,679 (GRCm39) nonsense probably null
R8696:Camsap3 UTSW 8 3,653,614 (GRCm39) missense probably damaging 1.00
R8804:Camsap3 UTSW 8 3,652,624 (GRCm39) missense probably benign 0.14
R9022:Camsap3 UTSW 8 3,656,575 (GRCm39) missense probably benign 0.08
R9380:Camsap3 UTSW 8 3,653,999 (GRCm39) missense probably benign 0.09
R9706:Camsap3 UTSW 8 3,658,689 (GRCm39) missense possibly damaging 0.92
Z1192:Camsap3 UTSW 8 3,654,124 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCAACATCATCCCGGAATTC -3'
(R):5'- CAGCTGTTTCTTGCGTTCAG -3'

Sequencing Primer
(F):5'- CGGAATTCTGCTCAGCCAG -3'
(R):5'- CAAAACTGGTCATCTTCACTTCGGAG -3'
Posted On 2014-07-14