Incidental Mutation 'R1899:Tgfbr3l'
ID 214094
Institutional Source Beutler Lab
Gene Symbol Tgfbr3l
Ensembl Gene ENSMUSG00000089736
Gene Name transforming growth factor, beta receptor III-like
Synonyms Gm14378, LOC100039590
MMRRC Submission 039919-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1899 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 4298214-4301423 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 4299600 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 128 (R128S)
Ref Sequence ENSEMBL: ENSMUSP00000106621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003027] [ENSMUST00000011981] [ENSMUST00000062686] [ENSMUST00000110993] [ENSMUST00000110994] [ENSMUST00000110995] [ENSMUST00000110996] [ENSMUST00000110998] [ENSMUST00000110999] [ENSMUST00000208316] [ENSMUST00000208459] [ENSMUST00000129866] [ENSMUST00000145165]
AlphaFold D3YZZ2
Predicted Effect probably benign
Transcript: ENSMUST00000003027
SMART Domains Protein: ENSMUSP00000003027
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
low complexity region 435 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000011981
SMART Domains Protein: ENSMUSP00000011981
Gene: ENSMUSG00000011837

DomainStartEndE-ValueType
Pfam:SnAPC_2_like 1 356 5.9e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062686
SMART Domains Protein: ENSMUSP00000054512
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110993
AA Change: R128S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106621
Gene: ENSMUSG00000089736
AA Change: R128S

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
Pfam:Zona_pellucida 16 161 6.6e-15 PFAM
low complexity region 210 224 N/A INTRINSIC
low complexity region 227 263 N/A INTRINSIC
low complexity region 269 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110994
SMART Domains Protein: ENSMUSP00000106622
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110995
SMART Domains Protein: ENSMUSP00000106623
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
S_TKc 47 307 8.43e-72 SMART
low complexity region 346 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110996
SMART Domains Protein: ENSMUSP00000106624
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
S_TKc 92 352 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110998
SMART Domains Protein: ENSMUSP00000106626
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110999
SMART Domains Protein: ENSMUSP00000106627
Gene: ENSMUSG00000002948

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 53 73 N/A INTRINSIC
S_TKc 120 380 8.43e-72 SMART
low complexity region 419 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124750
Predicted Effect probably benign
Transcript: ENSMUST00000208316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209051
Predicted Effect probably benign
Transcript: ENSMUST00000208459
Predicted Effect probably benign
Transcript: ENSMUST00000129866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208029
Predicted Effect probably benign
Transcript: ENSMUST00000145165
SMART Domains Protein: ENSMUSP00000117418
Gene: ENSMUSG00000109061

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 69 89 N/A INTRINSIC
S_TKc 136 396 8.43e-72 SMART
Meta Mutation Damage Score 0.1359 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,884,664 (GRCm39) Q398L probably benign Het
4930596D02Rik T G 14: 35,532,089 (GRCm39) K162T probably damaging Het
Abca8b G T 11: 109,828,744 (GRCm39) T1353K possibly damaging Het
Abcg3 A C 5: 105,086,065 (GRCm39) C565G probably damaging Het
Actr3b G A 5: 26,034,536 (GRCm39) V185I possibly damaging Het
Akap6 A T 12: 53,188,635 (GRCm39) E2016D possibly damaging Het
Aldh3b2 T C 19: 4,028,662 (GRCm39) V148A possibly damaging Het
Ankfy1 C T 11: 72,645,233 (GRCm39) Q771* probably null Het
Anks1b A G 10: 90,096,618 (GRCm39) D425G probably damaging Het
Arrb1 T C 7: 99,231,504 (GRCm39) probably benign Het
Atg2a C A 19: 6,295,097 (GRCm39) T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 (GRCm39) R617C possibly damaging Het
Bicra T C 7: 15,721,676 (GRCm39) T614A possibly damaging Het
Cacna1i A G 15: 80,275,843 (GRCm39) D167G possibly damaging Het
Calr4 T G 4: 109,103,490 (GRCm39) probably null Het
Camsap3 G T 8: 3,653,922 (GRCm39) E515* probably null Het
Casp8ap2 T C 4: 32,643,647 (GRCm39) S907P probably damaging Het
Cdk19 T A 10: 40,355,776 (GRCm39) probably benign Het
Chst14 A G 2: 118,757,496 (GRCm39) M122V possibly damaging Het
Cntn4 A G 6: 106,652,774 (GRCm39) M748V probably benign Het
Col7a1 A G 9: 108,807,956 (GRCm39) D2552G unknown Het
Cpeb2 C A 5: 43,434,930 (GRCm39) P600Q probably damaging Het
Cyp2a5 C T 7: 26,538,458 (GRCm39) R274* probably null Het
Dele1 T C 18: 38,391,395 (GRCm39) W378R probably benign Het
Dexi A G 16: 10,360,382 (GRCm39) F58S probably damaging Het
Dlg5 C A 14: 24,198,368 (GRCm39) G1522W probably damaging Het
Dock2 T C 11: 34,244,286 (GRCm39) H1048R probably benign Het
Dpp4 T C 2: 62,175,394 (GRCm39) probably benign Het
Dusp10 A T 1: 183,801,377 (GRCm39) K381N possibly damaging Het
Ercc4 A G 16: 12,965,651 (GRCm39) E761G probably damaging Het
Ern2 T C 7: 121,783,065 (GRCm39) probably benign Het
Fam83f A T 15: 80,576,281 (GRCm39) T311S probably damaging Het
Fat2 T C 11: 55,153,004 (GRCm39) D3736G probably benign Het
Fgf11 G T 11: 69,692,279 (GRCm39) T58K probably benign Het
Galntl5 C G 5: 25,403,530 (GRCm39) S167* probably null Het
Glg1 T G 8: 111,892,306 (GRCm39) E846D probably benign Het
Grm8 C A 6: 28,125,894 (GRCm39) E77D probably damaging Het
Hmcn1 A T 1: 150,533,202 (GRCm39) D3028E probably damaging Het
Htt A G 5: 35,064,429 (GRCm39) I2943V probably benign Het
Ift80 T C 3: 68,825,846 (GRCm39) K498R probably benign Het
Ipo9 A T 1: 135,327,884 (GRCm39) M509K probably damaging Het
Kcnj3 T C 2: 55,327,256 (GRCm39) V15A probably damaging Het
Kcnn3 A T 3: 89,427,762 (GRCm39) probably benign Het
Larp1b T A 3: 40,918,519 (GRCm39) D53E probably benign Het
Ltf T C 9: 110,851,913 (GRCm39) F117L possibly damaging Het
Maml1 A G 11: 50,156,957 (GRCm39) L406P probably damaging Het
Mnx1 G A 5: 29,678,955 (GRCm39) A376V unknown Het
Mroh2a G A 1: 88,163,098 (GRCm39) R376H probably benign Het
Mrpl4 A G 9: 20,918,127 (GRCm39) Y111C probably damaging Het
Mto1 T C 9: 78,368,799 (GRCm39) probably benign Het
Nalcn A T 14: 123,553,538 (GRCm39) M972K possibly damaging Het
Nemf T C 12: 69,393,152 (GRCm39) I225V probably null Het
Nipal4 T G 11: 46,041,058 (GRCm39) D379A probably damaging Het
Nktr A G 9: 121,577,932 (GRCm39) probably benign Het
Nlrp5 A G 7: 23,104,222 (GRCm39) T28A probably benign Het
Nxph1 T A 6: 9,247,622 (GRCm39) Y198N probably damaging Het
Or4c123 T C 2: 89,127,014 (GRCm39) N200S probably damaging Het
Or5an10 T C 19: 12,275,707 (GRCm39) Y263C probably damaging Het
Or8u10 A T 2: 85,916,064 (GRCm39) V19D probably benign Het
P2rx7 A G 5: 122,811,799 (GRCm39) Y370C probably benign Het
Piezo1 T C 8: 123,209,384 (GRCm39) probably benign Het
Piezo1 T C 8: 123,216,305 (GRCm39) D1401G probably damaging Het
Plxnd1 A G 6: 115,946,324 (GRCm39) L879P probably benign Het
Polr2a A T 11: 69,634,772 (GRCm39) I636N probably damaging Het
Prex2 G T 1: 11,232,590 (GRCm39) E886* probably null Het
Proca1 A T 11: 78,095,847 (GRCm39) I73F probably damaging Het
Prss55 A T 14: 64,316,839 (GRCm39) V101E probably benign Het
Psg26 T A 7: 18,212,350 (GRCm39) H335L probably benign Het
Rai1 A G 11: 60,076,746 (GRCm39) E270G probably benign Het
Reep1 A G 6: 71,757,781 (GRCm39) N127D probably benign Het
Rims1 G T 1: 22,498,725 (GRCm39) P769Q probably damaging Het
Robo4 A T 9: 37,315,366 (GRCm39) probably benign Het
Ryr2 A T 13: 11,606,222 (GRCm39) D888E probably benign Het
Scamp3 A G 3: 89,087,567 (GRCm39) N135D probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sema4f A G 6: 82,895,010 (GRCm39) M395T probably benign Het
Sgip1 T C 4: 102,825,534 (GRCm39) probably null Het
Sik2 A T 9: 50,906,974 (GRCm39) probably benign Het
Smtn G T 11: 3,481,326 (GRCm39) A223D possibly damaging Het
Spen T C 4: 141,197,654 (GRCm39) T3405A probably benign Het
Srebf1 A G 11: 60,094,312 (GRCm39) L601P probably damaging Het
Srsf11 A T 3: 157,737,217 (GRCm39) probably benign Het
Tacc2 T G 7: 130,225,932 (GRCm39) S891R possibly damaging Het
Tbc1d17 T A 7: 44,491,057 (GRCm39) probably benign Het
Thsd1 G A 8: 22,742,334 (GRCm39) probably benign Het
Tlx3 T C 11: 33,153,072 (GRCm39) S130G probably benign Het
Tmem25 A T 9: 44,709,513 (GRCm39) probably null Het
Trak2 A T 1: 58,985,495 (GRCm39) M1K probably null Het
Trappc12 C T 12: 28,796,984 (GRCm39) E183K probably damaging Het
Ubl3 A G 5: 148,446,090 (GRCm39) V71A possibly damaging Het
Unc50 A G 1: 37,477,880 (GRCm39) Y254C probably damaging Het
Unkl T C 17: 25,448,434 (GRCm39) probably null Het
Uso1 T A 5: 92,349,051 (GRCm39) S819T probably benign Het
Yes1 A T 5: 32,802,395 (GRCm39) R103S probably damaging Het
Zfp131 A G 13: 120,228,561 (GRCm39) V396A probably damaging Het
Zfp553 T C 7: 126,834,826 (GRCm39) I127T possibly damaging Het
Zfp599 A T 9: 22,162,845 (GRCm39) N102K probably benign Het
Zmynd10 A T 9: 107,427,236 (GRCm39) Q288L probably benign Het
Other mutations in Tgfbr3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0526:Tgfbr3l UTSW 8 4,299,439 (GRCm39) missense possibly damaging 0.93
R1757:Tgfbr3l UTSW 8 4,299,548 (GRCm39) missense probably benign 0.43
R1764:Tgfbr3l UTSW 8 4,299,282 (GRCm39) missense probably benign 0.02
R2266:Tgfbr3l UTSW 8 4,300,506 (GRCm39) missense probably benign 0.01
R2267:Tgfbr3l UTSW 8 4,300,506 (GRCm39) missense probably benign 0.01
R2268:Tgfbr3l UTSW 8 4,300,506 (GRCm39) missense probably benign 0.01
R2844:Tgfbr3l UTSW 8 4,299,280 (GRCm39) missense probably damaging 0.97
R2845:Tgfbr3l UTSW 8 4,299,280 (GRCm39) missense probably damaging 0.97
R2846:Tgfbr3l UTSW 8 4,299,280 (GRCm39) missense probably damaging 0.97
R4695:Tgfbr3l UTSW 8 4,300,574 (GRCm39) missense probably benign 0.33
R5059:Tgfbr3l UTSW 8 4,299,343 (GRCm39) critical splice donor site probably null
R5708:Tgfbr3l UTSW 8 4,300,360 (GRCm39) missense probably damaging 0.96
R5749:Tgfbr3l UTSW 8 4,299,310 (GRCm39) missense probably damaging 0.97
R6898:Tgfbr3l UTSW 8 4,300,365 (GRCm39) missense possibly damaging 0.70
R7078:Tgfbr3l UTSW 8 4,299,238 (GRCm39) missense probably damaging 0.98
R7745:Tgfbr3l UTSW 8 4,300,622 (GRCm39) missense possibly damaging 0.73
R9013:Tgfbr3l UTSW 8 4,300,620 (GRCm39) missense possibly damaging 0.53
R9368:Tgfbr3l UTSW 8 4,299,640 (GRCm39) missense probably damaging 0.99
R9539:Tgfbr3l UTSW 8 4,299,679 (GRCm39) missense probably damaging 0.99
X0021:Tgfbr3l UTSW 8 4,299,642 (GRCm39) missense probably damaging 0.97
Z1176:Tgfbr3l UTSW 8 4,300,508 (GRCm39) missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TTGATGGCGCCTTGATCCTG -3'
(R):5'- CTGCCAGAAATGCCTTTGCC -3'

Sequencing Primer
(F):5'- TTGATCCTGCAGGCGGC -3'
(R):5'- CAGAAATGCCTTTGCCTAGCTAGAG -3'
Posted On 2014-07-14