Incidental Mutation 'R1899:Glg1'
ID214096
Institutional Source Beutler Lab
Gene Symbol Glg1
Ensembl Gene ENSMUSG00000003316
Gene Namegolgi apparatus protein 1
SynonymsSelel, CFR, MG-160, CFR-1, ESL-1, MG160
MMRRC Submission 039919-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.711) question?
Stock #R1899 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111154421-111259216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 111165674 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 846 (E846D)
Ref Sequence ENSEMBL: ENSMUSP00000131355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003404] [ENSMUST00000164283] [ENSMUST00000168741] [ENSMUST00000169020]
Predicted Effect probably benign
Transcript: ENSMUST00000003404
AA Change: E835D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000003404
Gene: ENSMUSG00000003316
AA Change: E835D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 141 197 3.1e-13 PFAM
Pfam:Cys_rich_FGFR 199 263 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 274 331 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 334 398 1.6e-16 PFAM
Pfam:Cys_rich_FGFR 402 458 1.8e-15 PFAM
Pfam:Cys_rich_FGFR 463 522 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 525 589 5.8e-19 PFAM
Pfam:Cys_rich_FGFR 597 653 6e-17 PFAM
Pfam:Cys_rich_FGFR 654 714 2e-14 PFAM
Pfam:Cys_rich_FGFR 717 773 4.7e-14 PFAM
Pfam:Cys_rich_FGFR 784 841 1e-18 PFAM
Pfam:Cys_rich_FGFR 842 897 4.2e-17 PFAM
Pfam:Cys_rich_FGFR 900 964 2.1e-21 PFAM
Pfam:Cys_rich_FGFR 967 1027 3.5e-16 PFAM
Pfam:Cys_rich_FGFR 1029 1086 8e-17 PFAM
transmembrane domain 1131 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164283
SMART Domains Protein: ENSMUSP00000131659
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 210 267 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168741
AA Change: E239D

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130327
Gene: ENSMUSG00000003316
AA Change: E239D

DomainStartEndE-ValueType
Pfam:Cys_rich_FGFR 1 57 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 58 118 8.5e-15 PFAM
Pfam:Cys_rich_FGFR 121 177 2e-14 PFAM
Pfam:Cys_rich_FGFR 188 245 4.3e-19 PFAM
Pfam:Cys_rich_FGFR 246 301 1.8e-17 PFAM
Pfam:Cys_rich_FGFR 304 368 8.9e-22 PFAM
Pfam:Cys_rich_FGFR 371 431 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 459 513 1.6e-15 PFAM
transmembrane domain 558 580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169020
AA Change: E846D

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131355
Gene: ENSMUSG00000003316
AA Change: E846D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.9e-15 PFAM
Pfam:Cys_rich_FGFR 210 274 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 285 342 1.4e-16 PFAM
Pfam:Cys_rich_FGFR 345 409 7.2e-16 PFAM
Pfam:Cys_rich_FGFR 413 469 8.4e-16 PFAM
Pfam:Cys_rich_FGFR 474 533 6.4e-17 PFAM
Pfam:Cys_rich_FGFR 536 600 2.7e-16 PFAM
Pfam:Cys_rich_FGFR 608 664 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 665 725 1.2e-13 PFAM
Pfam:Cys_rich_FGFR 728 784 2.6e-11 PFAM
Pfam:Cys_rich_FGFR 795 852 1.4e-18 PFAM
Pfam:Cys_rich_FGFR 853 908 1.1e-15 PFAM
Pfam:Cys_rich_FGFR 911 975 1e-19 PFAM
Pfam:Cys_rich_FGFR 978 1038 1.3e-15 PFAM
Pfam:Cys_rich_FGFR 1040 1097 6e-17 PFAM
transmembrane domain 1142 1164 N/A INTRINSIC
Meta Mutation Damage Score 0.0642 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype PHENOTYPE: Nullizygous mice show smaller size, narrow rib cages, short and thin bony elements, and reduced chondrocyte proliferation and growth plates. Homozygotes for a gene trap allele show postnatal death, small size, distorted tails and cleft palate. Homozygotes for another gene trap allele die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,258,342 W378R probably benign Het
4930522L14Rik T A 5: 109,736,798 Q398L probably benign Het
4930596D02Rik T G 14: 35,810,132 K162T probably damaging Het
Abca8b G T 11: 109,937,918 T1353K possibly damaging Het
Abcg3 A C 5: 104,938,199 C565G probably damaging Het
Actr3b G A 5: 25,829,538 V185I possibly damaging Het
Akap6 A T 12: 53,141,852 E2016D possibly damaging Het
Aldh3b2 T C 19: 3,978,662 V148A possibly damaging Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arrb1 T C 7: 99,582,297 probably benign Het
Atg2a C A 19: 6,245,067 T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 R617C possibly damaging Het
Bicra T C 7: 15,987,751 T614A possibly damaging Het
Cacna1i A G 15: 80,391,642 D167G possibly damaging Het
Calr4 T G 4: 109,246,293 probably null Het
Camsap3 G T 8: 3,603,922 E515* probably null Het
Casp8ap2 T C 4: 32,643,647 S907P probably damaging Het
Cdk19 T A 10: 40,479,780 probably benign Het
Chst14 A G 2: 118,927,015 M122V possibly damaging Het
Cntn4 A G 6: 106,675,813 M748V probably benign Het
Col7a1 A G 9: 108,978,888 D2552G unknown Het
Cpeb2 C A 5: 43,277,587 P600Q probably damaging Het
Cyp2a5 C T 7: 26,839,033 R274* probably null Het
Dexi A G 16: 10,542,518 F58S probably damaging Het
Dlg5 C A 14: 24,148,300 G1522W probably damaging Het
Dock2 T C 11: 34,294,286 H1048R probably benign Het
Dpp4 T C 2: 62,345,050 probably benign Het
Dusp10 A T 1: 184,069,180 K381N possibly damaging Het
Ercc4 A G 16: 13,147,787 E761G probably damaging Het
Ern2 T C 7: 122,183,842 probably benign Het
Fam83f A T 15: 80,692,080 T311S probably damaging Het
Fat2 T C 11: 55,262,178 D3736G probably benign Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Galntl5 C G 5: 25,198,532 S167* probably null Het
Grm8 C A 6: 28,125,895 E77D probably damaging Het
Hmcn1 A T 1: 150,657,451 D3028E probably damaging Het
Htt A G 5: 34,907,085 I2943V probably benign Het
Ift80 T C 3: 68,918,513 K498R probably benign Het
Ipo9 A T 1: 135,400,146 M509K probably damaging Het
Kcnj3 T C 2: 55,437,244 V15A probably damaging Het
Kcnn3 A T 3: 89,520,455 probably benign Het
Larp1b T A 3: 40,964,084 D53E probably benign Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Maml1 A G 11: 50,266,130 L406P probably damaging Het
Mnx1 G A 5: 29,473,957 A376V unknown Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mrpl4 A G 9: 21,006,831 Y111C probably damaging Het
Mto1 T C 9: 78,461,517 probably benign Het
Nalcn A T 14: 123,316,126 M972K possibly damaging Het
Nemf T C 12: 69,346,378 I225V probably null Het
Nipal4 T G 11: 46,150,231 D379A probably damaging Het
Nktr A G 9: 121,748,866 probably benign Het
Nlrp5 A G 7: 23,404,797 T28A probably benign Het
Nxph1 T A 6: 9,247,622 Y198N probably damaging Het
Olfr1037 A T 2: 86,085,720 V19D probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1436 T C 19: 12,298,343 Y263C probably damaging Het
P2rx7 A G 5: 122,673,736 Y370C probably benign Het
Piezo1 T C 8: 122,482,645 probably benign Het
Piezo1 T C 8: 122,489,566 D1401G probably damaging Het
Plxnd1 A G 6: 115,969,363 L879P probably benign Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prss55 A T 14: 64,079,390 V101E probably benign Het
Psg26 T A 7: 18,478,425 H335L probably benign Het
Rai1 A G 11: 60,185,920 E270G probably benign Het
Reep1 A G 6: 71,780,797 N127D probably benign Het
Rims1 G T 1: 22,428,474 P769Q probably damaging Het
Robo4 A T 9: 37,404,070 probably benign Het
Ryr2 A T 13: 11,591,336 D888E probably benign Het
Scamp3 A G 3: 89,180,260 N135D probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema4f A G 6: 82,918,029 M395T probably benign Het
Sgip1 T C 4: 102,968,337 probably null Het
Sik2 A T 9: 50,995,674 probably benign Het
Smtn G T 11: 3,531,326 A223D possibly damaging Het
Spen T C 4: 141,470,343 T3405A probably benign Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Srsf11 A T 3: 158,031,580 probably benign Het
Tacc2 T G 7: 130,624,202 S891R possibly damaging Het
Tbc1d17 T A 7: 44,841,633 probably benign Het
Tgfbr3l C A 8: 4,249,600 R128S probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tlx3 T C 11: 33,203,072 S130G probably benign Het
Tmem25 A T 9: 44,798,216 probably null Het
Trak2 A T 1: 58,946,336 M1K probably null Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Ubl3 A G 5: 148,509,280 V71A possibly damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unkl T C 17: 25,229,460 probably null Het
Uso1 T A 5: 92,201,192 S819T probably benign Het
Yes1 A T 5: 32,645,051 R103S probably damaging Het
Zfp131 A G 13: 119,767,025 V396A probably damaging Het
Zfp553 T C 7: 127,235,654 I127T possibly damaging Het
Zfp599 A T 9: 22,251,549 N102K probably benign Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Other mutations in Glg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Glg1 APN 8 111159849 missense probably damaging 1.00
IGL01326:Glg1 APN 8 111182573 missense probably damaging 0.96
IGL01558:Glg1 APN 8 111187730 missense probably benign 0.00
IGL01798:Glg1 APN 8 111192700 missense possibly damaging 0.58
IGL02651:Glg1 APN 8 111160727 missense possibly damaging 0.76
IGL03124:Glg1 APN 8 111200171 missense probably damaging 1.00
IGL03374:Glg1 APN 8 111162780 missense probably damaging 1.00
IGL03404:Glg1 APN 8 111159902 missense probably damaging 1.00
diabolical UTSW 8 111168743 missense probably damaging 1.00
PIT4362001:Glg1 UTSW 8 111258799 missense possibly damaging 0.80
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0047:Glg1 UTSW 8 111165582 missense probably damaging 1.00
R0255:Glg1 UTSW 8 111159858 missense possibly damaging 0.82
R0432:Glg1 UTSW 8 111182569 missense probably damaging 1.00
R0458:Glg1 UTSW 8 111160606 splice site probably benign
R0635:Glg1 UTSW 8 111163764 splice site probably benign
R0765:Glg1 UTSW 8 111159797 critical splice donor site probably null
R1104:Glg1 UTSW 8 111197603 missense probably benign 0.01
R1495:Glg1 UTSW 8 111197675 missense probably damaging 1.00
R1747:Glg1 UTSW 8 111197673 missense probably damaging 1.00
R1950:Glg1 UTSW 8 111165639 missense possibly damaging 0.79
R2074:Glg1 UTSW 8 111168671 missense probably damaging 1.00
R2112:Glg1 UTSW 8 111192546 missense probably damaging 1.00
R2275:Glg1 UTSW 8 111168721 nonsense probably null
R2342:Glg1 UTSW 8 111187807 nonsense probably null
R4633:Glg1 UTSW 8 111177644 critical splice donor site probably null
R4716:Glg1 UTSW 8 111160775 nonsense probably null
R4732:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R4733:Glg1 UTSW 8 111187755 missense probably damaging 1.00
R5594:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R5722:Glg1 UTSW 8 111169562 missense possibly damaging 0.67
R5951:Glg1 UTSW 8 111165691 missense possibly damaging 0.64
R5958:Glg1 UTSW 8 111259104 missense probably benign 0.01
R6090:Glg1 UTSW 8 111181035 missense probably damaging 1.00
R6476:Glg1 UTSW 8 111200174 missense possibly damaging 0.94
R6480:Glg1 UTSW 8 111197706 missense possibly damaging 0.89
R6819:Glg1 UTSW 8 111187881 missense probably damaging 1.00
R7116:Glg1 UTSW 8 111178957 missense probably benign 0.22
R7293:Glg1 UTSW 8 111168743 missense probably damaging 1.00
R7431:Glg1 UTSW 8 111160754 missense unknown
R7479:Glg1 UTSW 8 111197735 missense possibly damaging 0.91
R7509:Glg1 UTSW 8 111259043 missense probably benign 0.04
R7547:Glg1 UTSW 8 111187761 missense possibly damaging 0.89
R7678:Glg1 UTSW 8 111178865 missense probably benign 0.19
X0027:Glg1 UTSW 8 111169600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATTGGACTGTAGACCCACAGC -3'
(R):5'- TGAGTGTGTCAGTCAGAATCG -3'

Sequencing Primer
(F):5'- AGGGCATCACCATGTTGG -3'
(R):5'- TGTGTCAGTCAGAATCGATGAC -3'
Posted On2014-07-14