Incidental Mutation 'R1899:Piezo1'
ID 214097
Institutional Source Beutler Lab
Gene Symbol Piezo1
Ensembl Gene ENSMUSG00000014444
Gene Name piezo-type mechanosensitive ion channel component 1
Synonyms Fam38a, Piezo1
MMRRC Submission 039919-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1899 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 123208437-123278068 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 123209384 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000116412] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000134127] [ENSMUST00000156333] [ENSMUST00000136253] [ENSMUST00000146634] [ENSMUST00000151855]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000067252
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116412
SMART Domains Protein: ENSMUSP00000112113
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 1e-3 SMART
Pfam:CTU2 347 470 2.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126553
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128383
SMART Domains Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
transmembrane domain 406 428 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 567 584 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 716 733 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
transmembrane domain 803 820 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
coiled coil region 895 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131934
Predicted Effect probably benign
Transcript: ENSMUST00000134127
SMART Domains Protein: ENSMUSP00000119237
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
SCOP:d1sur__ 25 128 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134304
Predicted Effect probably benign
Transcript: ENSMUST00000156333
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154099
Predicted Effect probably benign
Transcript: ENSMUST00000212499
Predicted Effect probably benign
Transcript: ENSMUST00000148497
SMART Domains Protein: ENSMUSP00000121725
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 505 522 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Pfam:PIEZO 580 809 3.2e-98 PFAM
low complexity region 826 837 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136253
Predicted Effect probably benign
Transcript: ENSMUST00000146634
SMART Domains Protein: ENSMUSP00000119931
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 78 87 N/A INTRINSIC
low complexity region 96 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151855
SMART Domains Protein: ENSMUSP00000133622
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 9e-4 SMART
Pfam:DUF2392 277 377 1.7e-30 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T A 5: 109,884,664 (GRCm39) Q398L probably benign Het
4930596D02Rik T G 14: 35,532,089 (GRCm39) K162T probably damaging Het
Abca8b G T 11: 109,828,744 (GRCm39) T1353K possibly damaging Het
Abcg3 A C 5: 105,086,065 (GRCm39) C565G probably damaging Het
Actr3b G A 5: 26,034,536 (GRCm39) V185I possibly damaging Het
Akap6 A T 12: 53,188,635 (GRCm39) E2016D possibly damaging Het
Aldh3b2 T C 19: 4,028,662 (GRCm39) V148A possibly damaging Het
Ankfy1 C T 11: 72,645,233 (GRCm39) Q771* probably null Het
Anks1b A G 10: 90,096,618 (GRCm39) D425G probably damaging Het
Arrb1 T C 7: 99,231,504 (GRCm39) probably benign Het
Atg2a C A 19: 6,295,097 (GRCm39) T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 (GRCm39) R617C possibly damaging Het
Bicra T C 7: 15,721,676 (GRCm39) T614A possibly damaging Het
Cacna1i A G 15: 80,275,843 (GRCm39) D167G possibly damaging Het
Calr4 T G 4: 109,103,490 (GRCm39) probably null Het
Camsap3 G T 8: 3,653,922 (GRCm39) E515* probably null Het
Casp8ap2 T C 4: 32,643,647 (GRCm39) S907P probably damaging Het
Cdk19 T A 10: 40,355,776 (GRCm39) probably benign Het
Chst14 A G 2: 118,757,496 (GRCm39) M122V possibly damaging Het
Cntn4 A G 6: 106,652,774 (GRCm39) M748V probably benign Het
Col7a1 A G 9: 108,807,956 (GRCm39) D2552G unknown Het
Cpeb2 C A 5: 43,434,930 (GRCm39) P600Q probably damaging Het
Cyp2a5 C T 7: 26,538,458 (GRCm39) R274* probably null Het
Dele1 T C 18: 38,391,395 (GRCm39) W378R probably benign Het
Dexi A G 16: 10,360,382 (GRCm39) F58S probably damaging Het
Dlg5 C A 14: 24,198,368 (GRCm39) G1522W probably damaging Het
Dock2 T C 11: 34,244,286 (GRCm39) H1048R probably benign Het
Dpp4 T C 2: 62,175,394 (GRCm39) probably benign Het
Dusp10 A T 1: 183,801,377 (GRCm39) K381N possibly damaging Het
Ercc4 A G 16: 12,965,651 (GRCm39) E761G probably damaging Het
Ern2 T C 7: 121,783,065 (GRCm39) probably benign Het
Fam83f A T 15: 80,576,281 (GRCm39) T311S probably damaging Het
Fat2 T C 11: 55,153,004 (GRCm39) D3736G probably benign Het
Fgf11 G T 11: 69,692,279 (GRCm39) T58K probably benign Het
Galntl5 C G 5: 25,403,530 (GRCm39) S167* probably null Het
Glg1 T G 8: 111,892,306 (GRCm39) E846D probably benign Het
Grm8 C A 6: 28,125,894 (GRCm39) E77D probably damaging Het
Hmcn1 A T 1: 150,533,202 (GRCm39) D3028E probably damaging Het
Htt A G 5: 35,064,429 (GRCm39) I2943V probably benign Het
Ift80 T C 3: 68,825,846 (GRCm39) K498R probably benign Het
Ipo9 A T 1: 135,327,884 (GRCm39) M509K probably damaging Het
Kcnj3 T C 2: 55,327,256 (GRCm39) V15A probably damaging Het
Kcnn3 A T 3: 89,427,762 (GRCm39) probably benign Het
Larp1b T A 3: 40,918,519 (GRCm39) D53E probably benign Het
Ltf T C 9: 110,851,913 (GRCm39) F117L possibly damaging Het
Maml1 A G 11: 50,156,957 (GRCm39) L406P probably damaging Het
Mnx1 G A 5: 29,678,955 (GRCm39) A376V unknown Het
Mroh2a G A 1: 88,163,098 (GRCm39) R376H probably benign Het
Mrpl4 A G 9: 20,918,127 (GRCm39) Y111C probably damaging Het
Mto1 T C 9: 78,368,799 (GRCm39) probably benign Het
Nalcn A T 14: 123,553,538 (GRCm39) M972K possibly damaging Het
Nemf T C 12: 69,393,152 (GRCm39) I225V probably null Het
Nipal4 T G 11: 46,041,058 (GRCm39) D379A probably damaging Het
Nktr A G 9: 121,577,932 (GRCm39) probably benign Het
Nlrp5 A G 7: 23,104,222 (GRCm39) T28A probably benign Het
Nxph1 T A 6: 9,247,622 (GRCm39) Y198N probably damaging Het
Or4c123 T C 2: 89,127,014 (GRCm39) N200S probably damaging Het
Or5an10 T C 19: 12,275,707 (GRCm39) Y263C probably damaging Het
Or8u10 A T 2: 85,916,064 (GRCm39) V19D probably benign Het
P2rx7 A G 5: 122,811,799 (GRCm39) Y370C probably benign Het
Plxnd1 A G 6: 115,946,324 (GRCm39) L879P probably benign Het
Polr2a A T 11: 69,634,772 (GRCm39) I636N probably damaging Het
Prex2 G T 1: 11,232,590 (GRCm39) E886* probably null Het
Proca1 A T 11: 78,095,847 (GRCm39) I73F probably damaging Het
Prss55 A T 14: 64,316,839 (GRCm39) V101E probably benign Het
Psg26 T A 7: 18,212,350 (GRCm39) H335L probably benign Het
Rai1 A G 11: 60,076,746 (GRCm39) E270G probably benign Het
Reep1 A G 6: 71,757,781 (GRCm39) N127D probably benign Het
Rims1 G T 1: 22,498,725 (GRCm39) P769Q probably damaging Het
Robo4 A T 9: 37,315,366 (GRCm39) probably benign Het
Ryr2 A T 13: 11,606,222 (GRCm39) D888E probably benign Het
Scamp3 A G 3: 89,087,567 (GRCm39) N135D probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sema4f A G 6: 82,895,010 (GRCm39) M395T probably benign Het
Sgip1 T C 4: 102,825,534 (GRCm39) probably null Het
Sik2 A T 9: 50,906,974 (GRCm39) probably benign Het
Smtn G T 11: 3,481,326 (GRCm39) A223D possibly damaging Het
Spen T C 4: 141,197,654 (GRCm39) T3405A probably benign Het
Srebf1 A G 11: 60,094,312 (GRCm39) L601P probably damaging Het
Srsf11 A T 3: 157,737,217 (GRCm39) probably benign Het
Tacc2 T G 7: 130,225,932 (GRCm39) S891R possibly damaging Het
Tbc1d17 T A 7: 44,491,057 (GRCm39) probably benign Het
Tgfbr3l C A 8: 4,299,600 (GRCm39) R128S probably damaging Het
Thsd1 G A 8: 22,742,334 (GRCm39) probably benign Het
Tlx3 T C 11: 33,153,072 (GRCm39) S130G probably benign Het
Tmem25 A T 9: 44,709,513 (GRCm39) probably null Het
Trak2 A T 1: 58,985,495 (GRCm39) M1K probably null Het
Trappc12 C T 12: 28,796,984 (GRCm39) E183K probably damaging Het
Ubl3 A G 5: 148,446,090 (GRCm39) V71A possibly damaging Het
Unc50 A G 1: 37,477,880 (GRCm39) Y254C probably damaging Het
Unkl T C 17: 25,448,434 (GRCm39) probably null Het
Uso1 T A 5: 92,349,051 (GRCm39) S819T probably benign Het
Yes1 A T 5: 32,802,395 (GRCm39) R103S probably damaging Het
Zfp131 A G 13: 120,228,561 (GRCm39) V396A probably damaging Het
Zfp553 T C 7: 126,834,826 (GRCm39) I127T possibly damaging Het
Zfp599 A T 9: 22,162,845 (GRCm39) N102K probably benign Het
Zmynd10 A T 9: 107,427,236 (GRCm39) Q288L probably benign Het
Other mutations in Piezo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Piezo1 APN 8 123,224,609 (GRCm39) missense possibly damaging 0.91
IGL01094:Piezo1 APN 8 123,208,877 (GRCm39) missense probably damaging 0.99
IGL01321:Piezo1 APN 8 123,214,339 (GRCm39) missense probably damaging 0.99
IGL01695:Piezo1 APN 8 123,222,248 (GRCm39) missense possibly damaging 0.81
IGL01762:Piezo1 APN 8 123,214,668 (GRCm39) nonsense probably null
IGL01922:Piezo1 APN 8 123,219,431 (GRCm39) missense probably benign 0.41
IGL01953:Piezo1 APN 8 123,217,923 (GRCm39) missense probably damaging 1.00
IGL01997:Piezo1 APN 8 123,215,070 (GRCm39) splice site probably benign
IGL02381:Piezo1 APN 8 123,225,283 (GRCm39) missense probably benign 0.28
IGL02398:Piezo1 APN 8 123,213,302 (GRCm39) missense probably benign 0.21
IGL02562:Piezo1 APN 8 123,223,502 (GRCm39) missense probably benign 0.11
IGL02572:Piezo1 APN 8 123,212,044 (GRCm39) missense probably benign 0.28
IGL02691:Piezo1 APN 8 123,228,688 (GRCm39) missense possibly damaging 0.58
IGL02726:Piezo1 APN 8 123,213,894 (GRCm39) missense probably damaging 0.99
IGL02814:Piezo1 APN 8 123,224,954 (GRCm39) missense probably damaging 1.00
IGL02931:Piezo1 APN 8 123,210,258 (GRCm39) missense probably damaging 1.00
IGL03145:Piezo1 APN 8 123,209,660 (GRCm39) missense probably benign 0.14
FR4449:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
FR4548:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
FR4737:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
FR4976:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
LCD18:Piezo1 UTSW 8 123,222,308 (GRCm39) missense probably damaging 1.00
R0085:Piezo1 UTSW 8 123,228,354 (GRCm39) missense probably damaging 0.98
R0096:Piezo1 UTSW 8 123,212,109 (GRCm39) unclassified probably benign
R0970:Piezo1 UTSW 8 123,213,549 (GRCm39) missense possibly damaging 0.94
R1364:Piezo1 UTSW 8 123,225,310 (GRCm39) missense possibly damaging 0.61
R1460:Piezo1 UTSW 8 123,228,890 (GRCm39) missense possibly damaging 0.86
R1485:Piezo1 UTSW 8 123,208,788 (GRCm39) missense probably damaging 1.00
R1538:Piezo1 UTSW 8 123,218,142 (GRCm39) missense probably damaging 1.00
R1655:Piezo1 UTSW 8 123,223,561 (GRCm39) missense probably benign 0.09
R1700:Piezo1 UTSW 8 123,214,241 (GRCm39) missense probably damaging 1.00
R1860:Piezo1 UTSW 8 123,222,489 (GRCm39) missense possibly damaging 0.90
R1861:Piezo1 UTSW 8 123,222,489 (GRCm39) missense possibly damaging 0.90
R1899:Piezo1 UTSW 8 123,216,305 (GRCm39) missense probably damaging 1.00
R1900:Piezo1 UTSW 8 123,209,384 (GRCm39) unclassified probably benign
R2018:Piezo1 UTSW 8 123,209,451 (GRCm39) missense probably benign 0.43
R2019:Piezo1 UTSW 8 123,209,451 (GRCm39) missense probably benign 0.43
R2219:Piezo1 UTSW 8 123,218,227 (GRCm39) missense probably benign 0.01
R2331:Piezo1 UTSW 8 123,214,005 (GRCm39) splice site probably null
R3016:Piezo1 UTSW 8 123,232,766 (GRCm39) critical splice donor site probably null
R3699:Piezo1 UTSW 8 123,221,642 (GRCm39) missense probably damaging 1.00
R3700:Piezo1 UTSW 8 123,221,642 (GRCm39) missense probably damaging 1.00
R3746:Piezo1 UTSW 8 123,219,377 (GRCm39) missense probably damaging 1.00
R3905:Piezo1 UTSW 8 123,208,882 (GRCm39) missense probably damaging 1.00
R4093:Piezo1 UTSW 8 123,227,899 (GRCm39) critical splice donor site probably null
R4296:Piezo1 UTSW 8 123,217,866 (GRCm39) missense probably damaging 1.00
R4396:Piezo1 UTSW 8 123,225,413 (GRCm39) missense probably damaging 0.98
R4467:Piezo1 UTSW 8 123,213,135 (GRCm39) missense probably benign 0.17
R4614:Piezo1 UTSW 8 123,213,150 (GRCm39) missense probably benign 0.25
R4642:Piezo1 UTSW 8 123,222,193 (GRCm39) missense probably damaging 1.00
R4688:Piezo1 UTSW 8 123,215,278 (GRCm39) missense probably damaging 1.00
R4734:Piezo1 UTSW 8 123,224,945 (GRCm39) missense probably damaging 1.00
R4749:Piezo1 UTSW 8 123,224,945 (GRCm39) missense probably damaging 1.00
R4749:Piezo1 UTSW 8 123,213,678 (GRCm39) missense possibly damaging 0.48
R4865:Piezo1 UTSW 8 123,213,660 (GRCm39) missense probably damaging 1.00
R4869:Piezo1 UTSW 8 123,214,284 (GRCm39) missense probably benign
R4962:Piezo1 UTSW 8 123,213,220 (GRCm39) missense probably benign 0.41
R5026:Piezo1 UTSW 8 123,213,557 (GRCm39) missense probably benign 0.11
R5418:Piezo1 UTSW 8 123,213,519 (GRCm39) missense probably damaging 1.00
R5625:Piezo1 UTSW 8 123,209,699 (GRCm39) missense probably benign 0.01
R5759:Piezo1 UTSW 8 123,234,394 (GRCm39) missense probably damaging 0.98
R5864:Piezo1 UTSW 8 123,213,112 (GRCm39) missense possibly damaging 0.75
R5898:Piezo1 UTSW 8 123,214,682 (GRCm39) missense probably benign 0.00
R5948:Piezo1 UTSW 8 123,210,086 (GRCm39) missense probably benign 0.01
R6052:Piezo1 UTSW 8 123,233,008 (GRCm39) missense probably damaging 1.00
R6086:Piezo1 UTSW 8 123,228,396 (GRCm39) missense possibly damaging 0.73
R6216:Piezo1 UTSW 8 123,215,869 (GRCm39) missense probably benign 0.05
R6271:Piezo1 UTSW 8 123,221,671 (GRCm39) missense probably damaging 1.00
R6549:Piezo1 UTSW 8 123,227,002 (GRCm39) missense
R6723:Piezo1 UTSW 8 123,234,366 (GRCm39) missense probably benign 0.15
R6871:Piezo1 UTSW 8 123,211,766 (GRCm39) splice site probably null
R6919:Piezo1 UTSW 8 123,217,020 (GRCm39) missense probably damaging 1.00
R7085:Piezo1 UTSW 8 123,217,633 (GRCm39) missense
R7105:Piezo1 UTSW 8 123,208,857 (GRCm39) missense unknown
R7267:Piezo1 UTSW 8 123,224,268 (GRCm39) missense
R7337:Piezo1 UTSW 8 123,212,463 (GRCm39) missense
R7381:Piezo1 UTSW 8 123,228,397 (GRCm39) missense
R7480:Piezo1 UTSW 8 123,225,234 (GRCm39) nonsense probably null
R7515:Piezo1 UTSW 8 123,212,035 (GRCm39) missense
R7571:Piezo1 UTSW 8 123,225,157 (GRCm39) missense
R7601:Piezo1 UTSW 8 123,210,220 (GRCm39) splice site probably null
R7827:Piezo1 UTSW 8 123,209,659 (GRCm39) missense probably damaging 0.96
R7923:Piezo1 UTSW 8 123,223,183 (GRCm39) missense
R7975:Piezo1 UTSW 8 123,222,504 (GRCm39) missense
R8071:Piezo1 UTSW 8 123,213,750 (GRCm39) missense probably null
R8231:Piezo1 UTSW 8 123,232,836 (GRCm39) missense
R8270:Piezo1 UTSW 8 123,228,298 (GRCm39) missense
R8784:Piezo1 UTSW 8 123,223,328 (GRCm39) splice site probably benign
R8788:Piezo1 UTSW 8 123,228,533 (GRCm39) missense
R8829:Piezo1 UTSW 8 123,217,753 (GRCm39) missense
R8890:Piezo1 UTSW 8 123,216,330 (GRCm39) missense
R8950:Piezo1 UTSW 8 123,208,729 (GRCm39) missense probably benign 0.01
R8994:Piezo1 UTSW 8 123,209,829 (GRCm39) missense unknown
R9036:Piezo1 UTSW 8 123,215,090 (GRCm39) missense
R9145:Piezo1 UTSW 8 123,208,753 (GRCm39) missense unknown
R9146:Piezo1 UTSW 8 123,227,002 (GRCm39) missense
R9251:Piezo1 UTSW 8 123,219,354 (GRCm39) missense
R9307:Piezo1 UTSW 8 123,213,832 (GRCm39) missense
R9375:Piezo1 UTSW 8 123,228,604 (GRCm39) missense
R9424:Piezo1 UTSW 8 123,218,079 (GRCm39) missense
R9578:Piezo1 UTSW 8 123,224,214 (GRCm39) missense
R9722:Piezo1 UTSW 8 123,225,497 (GRCm39) missense
R9775:Piezo1 UTSW 8 123,208,927 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCACTGAAGATGACCATGGGC -3'
(R):5'- TAAGATGCCCCTGACCTGAG -3'

Sequencing Primer
(F):5'- TTGCAGTCAGCCTTGCAG -3'
(R):5'- CTGAGCAGTCAGTGTGAGTGG -3'
Posted On 2014-07-14