Mutagenetix > Incidental Mutation

Incidental Mutation 'R1899:Anks1b'

214110

Institutional Source

Beutler Lab

Gene Symbol

Anks1b

Ensembl Gene

ENSMUSG00000058589

Gene Name

ankyrin repeat and sterile alpha motif domain containing 1B

Synonyms

C030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik

MMRRC Submission

039919-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1899 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89873509-90973300 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 90260756 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 425 (D425G)

Ref Sequence

ENSEMBL: ENSMUSP00000138209 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099368] [ENSMUST00000182907] [ENSMUST00000182936] [ENSMUST00000183156]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099368
AA Change: D459G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589
AA Change: D459G

Domain	Start	End	E-Value	Type
low complexity region	21	46	N/A	INTRINSIC
ANK	58	87	1.88e-5	SMART
ANK	91	123	3.13e-2	SMART
ANK	127	156	6.92e-4	SMART
ANK	160	189	3.08e-1	SMART
ANK	193	222	1.43e-5	SMART
ANK	225	254	4.75e-2	SMART
low complexity region	498	513	N/A	INTRINSIC
low complexity region	551	577	N/A	INTRINSIC
low complexity region	659	670	N/A	INTRINSIC
SAM	806	875	2.06e-19	SMART
SAM	880	931	4.44e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182907

SMART Domains

Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

Domain	Start	End	E-Value	Type
low complexity region	21	45	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182936
AA Change: D425G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138209
Gene: ENSMUSG00000058589
AA Change: D425G

Domain	Start	End	E-Value	Type
low complexity region	21	46	N/A	INTRINSIC
ANK	58	87	1.88e-5	SMART
ANK	91	123	3.13e-2	SMART
ANK	127	156	6.92e-4	SMART
ANK	160	189	3.08e-1	SMART
ANK	193	222	1.43e-5	SMART
ANK	225	254	5.03e2	SMART
low complexity region	464	479	N/A	INTRINSIC
low complexity region	517	543	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000183156
AA Change: D459G

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589
AA Change: D459G

Domain	Start	End	E-Value	Type
low complexity region	21	46	N/A	INTRINSIC
ANK	58	87	1.88e-5	SMART
ANK	91	123	3.13e-2	SMART
ANK	127	156	6.92e-4	SMART
ANK	160	189	3.08e-1	SMART
ANK	193	222	1.43e-5	SMART
ANK	225	254	4.75e-2	SMART
low complexity region	498	513	N/A	INTRINSIC
low complexity region	551	577	N/A	INTRINSIC
low complexity region	659	670	N/A	INTRINSIC
SAM	806	875	2.06e-19	SMART
SAM	880	948	5.66e-17	SMART
low complexity region	968	983	N/A	INTRINSIC
PTB	1056	1194	2.94e-38	SMART

Meta Mutation Damage Score

0.1445

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.4%

Validation Efficiency

94% (94/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	T	C	18: 38,258,342	W378R	probably benign	Het
4930522L14Rik	T	A	5: 109,736,798	Q398L	probably benign	Het
4930596D02Rik	T	G	14: 35,810,132	K162T	probably damaging	Het
Abca8b	G	T	11: 109,937,918	T1353K	possibly damaging	Het
Abcg3	A	C	5: 104,938,199	C565G	probably damaging	Het
Actr3b	G	A	5: 25,829,538	V185I	possibly damaging	Het
Akap6	A	T	12: 53,141,852	E2016D	possibly damaging	Het
Aldh3b2	T	C	19: 3,978,662	V148A	possibly damaging	Het
Ankfy1	C	T	11: 72,754,407	Q771*	probably null	Het
Arrb1	T	C	7: 99,582,297		probably benign	Het
Atg2a	C	A	19: 6,245,067	T170N	probably damaging	Het
Atp8b5	C	T	4: 43,361,804	R617C	possibly damaging	Het
Bicra	T	C	7: 15,987,751	T614A	possibly damaging	Het
Cacna1i	A	G	15: 80,391,642	D167G	possibly damaging	Het
Calr4	T	G	4: 109,246,293		probably null	Het
Camsap3	G	T	8: 3,603,922	E515*	probably null	Het
Casp8ap2	T	C	4: 32,643,647	S907P	probably damaging	Het
Cdk19	T	A	10: 40,479,780		probably benign	Het
Chst14	A	G	2: 118,927,015	M122V	possibly damaging	Het
Cntn4	A	G	6: 106,675,813	M748V	probably benign	Het
Col7a1	A	G	9: 108,978,888	D2552G	unknown	Het
Cpeb2	C	A	5: 43,277,587	P600Q	probably damaging	Het
Cyp2a5	C	T	7: 26,839,033	R274*	probably null	Het
Dexi	A	G	16: 10,542,518	F58S	probably damaging	Het
Dlg5	C	A	14: 24,148,300	G1522W	probably damaging	Het
Dock2	T	C	11: 34,294,286	H1048R	probably benign	Het
Dpp4	T	C	2: 62,345,050		probably benign	Het
Dusp10	A	T	1: 184,069,180	K381N	possibly damaging	Het
Ercc4	A	G	16: 13,147,787	E761G	probably damaging	Het
Ern2	T	C	7: 122,183,842		probably benign	Het
Fam83f	A	T	15: 80,692,080	T311S	probably damaging	Het
Fat2	T	C	11: 55,262,178	D3736G	probably benign	Het
Fgf11	G	T	11: 69,801,453	T58K	probably benign	Het
Galntl5	C	G	5: 25,198,532	S167*	probably null	Het
Glg1	T	G	8: 111,165,674	E846D	probably benign	Het
Grm8	C	A	6: 28,125,895	E77D	probably damaging	Het
Hmcn1	A	T	1: 150,657,451	D3028E	probably damaging	Het
Htt	A	G	5: 34,907,085	I2943V	probably benign	Het
Ift80	T	C	3: 68,918,513	K498R	probably benign	Het
Ipo9	A	T	1: 135,400,146	M509K	probably damaging	Het
Kcnj3	T	C	2: 55,437,244	V15A	probably damaging	Het
Kcnn3	A	T	3: 89,520,455		probably benign	Het
Larp1b	T	A	3: 40,964,084	D53E	probably benign	Het
Ltf	T	C	9: 111,022,845	F117L	possibly damaging	Het
Maml1	A	G	11: 50,266,130	L406P	probably damaging	Het
Mnx1	G	A	5: 29,473,957	A376V	unknown	Het
Mroh2a	G	A	1: 88,235,376	R376H	probably benign	Het
Mrpl4	A	G	9: 21,006,831	Y111C	probably damaging	Het
Mto1	T	C	9: 78,461,517		probably benign	Het
Nalcn	A	T	14: 123,316,126	M972K	possibly damaging	Het
Nemf	T	C	12: 69,346,378	I225V	probably null	Het
Nipal4	T	G	11: 46,150,231	D379A	probably damaging	Het
Nktr	A	G	9: 121,748,866		probably benign	Het
Nlrp5	A	G	7: 23,404,797	T28A	probably benign	Het
Nxph1	T	A	6: 9,247,622	Y198N	probably damaging	Het
Olfr1037	A	T	2: 86,085,720	V19D	probably benign	Het
Olfr1230	T	C	2: 89,296,670	N200S	probably damaging	Het
Olfr1436	T	C	19: 12,298,343	Y263C	probably damaging	Het
P2rx7	A	G	5: 122,673,736	Y370C	probably benign	Het
Piezo1	T	C	8: 122,482,645		probably benign	Het
Piezo1	T	C	8: 122,489,566	D1401G	probably damaging	Het
Plxnd1	A	G	6: 115,969,363	L879P	probably benign	Het
Polr2a	A	T	11: 69,743,946	I636N	probably damaging	Het
Prex2	G	T	1: 11,162,366	E886*	probably null	Het
Proca1	A	T	11: 78,205,021	I73F	probably damaging	Het
Prss55	A	T	14: 64,079,390	V101E	probably benign	Het
Psg26	T	A	7: 18,478,425	H335L	probably benign	Het
Rai1	A	G	11: 60,185,920	E270G	probably benign	Het
Reep1	A	G	6: 71,780,797	N127D	probably benign	Het
Rims1	G	T	1: 22,428,474	P769Q	probably damaging	Het
Robo4	A	T	9: 37,404,070		probably benign	Het
Ryr2	A	T	13: 11,591,336	D888E	probably benign	Het
Scamp3	A	G	3: 89,180,260	N135D	probably damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sema4f	A	G	6: 82,918,029	M395T	probably benign	Het
Sgip1	T	C	4: 102,968,337		probably null	Het
Sik2	A	T	9: 50,995,674		probably benign	Het
Smtn	G	T	11: 3,531,326	A223D	possibly damaging	Het
Spen	T	C	4: 141,470,343	T3405A	probably benign	Het
Srebf1	A	G	11: 60,203,486	L601P	probably damaging	Het
Srsf11	A	T	3: 158,031,580		probably benign	Het
Tacc2	T	G	7: 130,624,202	S891R	possibly damaging	Het
Tbc1d17	T	A	7: 44,841,633		probably benign	Het
Tgfbr3l	C	A	8: 4,249,600	R128S	probably damaging	Het
Thsd1	G	A	8: 22,252,318		probably benign	Het
Tlx3	T	C	11: 33,203,072	S130G	probably benign	Het
Tmem25	A	T	9: 44,798,216		probably null	Het
Trak2	A	T	1: 58,946,336	M1K	probably null	Het
Trappc12	C	T	12: 28,746,985	E183K	probably damaging	Het
Ubl3	A	G	5: 148,509,280	V71A	possibly damaging	Het
Unc50	A	G	1: 37,438,799	Y254C	probably damaging	Het
Unkl	T	C	17: 25,229,460		probably null	Het
Uso1	T	A	5: 92,201,192	S819T	probably benign	Het
Yes1	A	T	5: 32,645,051	R103S	probably damaging	Het
Zfp131	A	G	13: 119,767,025	V396A	probably damaging	Het
Zfp553	T	C	7: 127,235,654	I127T	possibly damaging	Het
Zfp599	A	T	9: 22,251,549	N102K	probably benign	Het
Zmynd10	A	T	9: 107,550,037	Q288L	probably benign	Het

Other mutations in Anks1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01669:Anks1b	APN	10	90897238	splice site	probably benign
IGL01890:Anks1b	APN	10	90644527	missense	probably benign	0.15
IGL01966:Anks1b	APN	10	90895132	missense	probably damaging	1.00
IGL02176:Anks1b	APN	10	90042668	missense	probably damaging	0.99
IGL02205:Anks1b	APN	10	90071094	missense	probably benign	0.00
IGL02465:Anks1b	APN	10	90163265	nonsense	probably null
IGL02534:Anks1b	APN	10	90895117	missense	probably benign	0.45
IGL02554:Anks1b	APN	10	90921378	missense	probably damaging	1.00
IGL02820:Anks1b	APN	10	90077059	missense	possibly damaging	0.93
IGL03164:Anks1b	APN	10	90042692	missense	probably damaging	1.00
R0096:Anks1b	UTSW	10	90074062	missense	possibly damaging	0.90
R0482:Anks1b	UTSW	10	90359195	missense	probably benign	0.00
R0542:Anks1b	UTSW	10	90073967	splice site	probably benign
R0848:Anks1b	UTSW	10	90071125	missense	probably damaging	0.99
R1056:Anks1b	UTSW	10	90921429	splice site	probably null
R1398:Anks1b	UTSW	10	90050029	missense	probably damaging	1.00
R1446:Anks1b	UTSW	10	90511073	missense	probably benign	0.00
R1548:Anks1b	UTSW	10	90049985	missense	possibly damaging	0.79
R1551:Anks1b	UTSW	10	90076981	missense	probably benign	0.00
R1607:Anks1b	UTSW	10	90042548	missense	probably damaging	1.00
R1667:Anks1b	UTSW	10	90511184	critical splice donor site	probably null
R1701:Anks1b	UTSW	10	90049954	missense	probably damaging	1.00
R1843:Anks1b	UTSW	10	90512889	critical splice donor site	probably null
R1957:Anks1b	UTSW	10	90049930	missense	probably damaging	1.00
R2036:Anks1b	UTSW	10	90969853	missense	probably damaging	0.99
R2279:Anks1b	UTSW	10	90050096	missense	probably damaging	1.00
R2280:Anks1b	UTSW	10	90966302	missense	probably damaging	1.00
R2937:Anks1b	UTSW	10	90077066	missense	probably damaging	1.00
R3739:Anks1b	UTSW	10	90033216	missense	probably damaging	1.00
R4061:Anks1b	UTSW	10	90307622	missense	probably damaging	0.98
R4459:Anks1b	UTSW	10	90510844	missense	probably damaging	1.00
R4479:Anks1b	UTSW	10	90049892	missense	probably damaging	1.00
R4510:Anks1b	UTSW	10	90510790	missense	probably benign	0.01
R4511:Anks1b	UTSW	10	90510790	missense	probably benign	0.01
R4780:Anks1b	UTSW	10	89873732	missense	probably damaging	1.00
R4785:Anks1b	UTSW	10	90914750	missense	probably null	0.88
R4790:Anks1b	UTSW	10	90163275	missense	probably damaging	0.99
R5012:Anks1b	UTSW	10	90359137	missense	probably benign	0.06
R5400:Anks1b	UTSW	10	90512824	missense	probably damaging	1.00
R5586:Anks1b	UTSW	10	90077064	missense	probably damaging	0.98
R5687:Anks1b	UTSW	10	90914711	missense	probably benign	0.03
R5899:Anks1b	UTSW	10	90923517	splice site	probably null
R5917:Anks1b	UTSW	10	90576941	intron	probably benign
R5999:Anks1b	UTSW	10	90359048	missense	probably damaging	1.00
R6080:Anks1b	UTSW	10	90966349	nonsense	probably null
R6216:Anks1b	UTSW	10	90260756	missense	probably damaging	1.00
R6265:Anks1b	UTSW	10	90941500	missense	probably damaging	1.00
R6298:Anks1b	UTSW	10	90680837	missense	probably damaging	1.00
R6337:Anks1b	UTSW	10	90921296	missense	probably benign	0.27
R6522:Anks1b	UTSW	10	90897327	intron	probably benign
R6843:Anks1b	UTSW	10	90948598	missense	probably damaging	1.00
R6852:Anks1b	UTSW	10	90260654	missense	probably damaging	1.00
R6933:Anks1b	UTSW	10	90069490	missense	probably damaging	1.00
R7114:Anks1b	UTSW	10	90307698	missense	probably damaging	1.00
R7211:Anks1b	UTSW	10	90511070	missense	possibly damaging	0.94
R7241:Anks1b	UTSW	10	90512837	missense	probably damaging	1.00
R7264:Anks1b	UTSW	10	90512870	missense	probably benign	0.08
R7325:Anks1b	UTSW	10	90941432	missense	probably damaging	1.00
R7392:Anks1b	UTSW	10	90680786	missense	possibly damaging	0.47
R7578:Anks1b	UTSW	10	90049927	missense	probably damaging	1.00
R7604:Anks1b	UTSW	10	90260846	splice site	probably null
R7633:Anks1b	UTSW	10	90948584	missense	probably damaging	1.00
R7881:Anks1b	UTSW	10	90967018	missense	probably benign	0.07
R7910:Anks1b	UTSW	10	90680792	missense	probably damaging	1.00
R7941:Anks1b	UTSW	10	90577155	missense	probably damaging	0.98
R8045:Anks1b	UTSW	10	90680860	missense	probably benign
R8146:Anks1b	UTSW	10	90307698	missense	probably damaging	1.00
R8176:Anks1b	UTSW	10	90069491	missense	probably damaging	1.00
R8535:Anks1b	UTSW	10	90948631	missense	probably benign	0.00
R8681:Anks1b	UTSW	10	90050006	missense	probably damaging	0.99
R9300:Anks1b	UTSW	10	90577104	missense	possibly damaging	0.93
R9469:Anks1b	UTSW	10	90897343	missense	possibly damaging	0.58
R9541:Anks1b	UTSW	10	90577085	missense	probably benign	0.02
R9550:Anks1b	UTSW	10	90576498	start codon destroyed	probably null
R9653:Anks1b	UTSW	10	90510662	missense	probably damaging	1.00
RF004:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF008:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF017:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF018:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
RF023:Anks1b	UTSW	10	90033225	missense	probably damaging	1.00
X0064:Anks1b	UTSW	10	90512845	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGCTAAGTTGGTACCAGTAGAC -3'
(R):5'- TGCAAAATTGATCATTGGGGC -3'

Sequencing Primer
(F):5'- AAGTTGGTACCAGTAGACCTGTGATC -3'
(R):5'- GCAAAATTGATCATTGGGGCTATCC -3'

Posted On

2014-07-14