Incidental Mutation 'R1899:Trappc12'
ID214124
Institutional Source Beutler Lab
Gene Symbol Trappc12
Ensembl Gene ENSMUSG00000020628
Gene Nametrafficking protein particle complex 12
SynonymsTtc15, D930014A20Rik, CGI-87
MMRRC Submission 039919-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R1899 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location28690628-28750472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28746985 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 183 (E183K)
Ref Sequence ENSEMBL: ENSMUSP00000127752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020954] [ENSMUST00000035657] [ENSMUST00000168129] [ENSMUST00000170994] [ENSMUST00000221555] [ENSMUST00000221877] [ENSMUST00000222407]
Predicted Effect probably benign
Transcript: ENSMUST00000020954
AA Change: E183K

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020954
Gene: ENSMUSG00000020628
AA Change: E183K

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035657
SMART Domains Protein: ENSMUSP00000038845
Gene: ENSMUSG00000036613

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
Blast:WD40 57 100 1e-18 BLAST
WD40 122 163 6.39e0 SMART
WD40 172 213 2.29e1 SMART
WD40 216 257 6.38e-7 SMART
WD40 261 301 4.38e-5 SMART
WD40 335 375 1.2e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168129
AA Change: E183K

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127752
Gene: ENSMUSG00000020628
AA Change: E183K

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
TPR 607 640 3.67e-3 SMART
TPR 642 675 1.44e1 SMART
TPR 682 715 3.37e-2 SMART
TPR 716 749 2.99e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170994
AA Change: E183K

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132009
Gene: ENSMUSG00000020628
AA Change: E183K

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221335
Predicted Effect probably benign
Transcript: ENSMUST00000221555
Predicted Effect probably benign
Transcript: ENSMUST00000221877
Predicted Effect probably benign
Transcript: ENSMUST00000222407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223552
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,258,342 W378R probably benign Het
4930522L14Rik T A 5: 109,736,798 Q398L probably benign Het
4930596D02Rik T G 14: 35,810,132 K162T probably damaging Het
Abca8b G T 11: 109,937,918 T1353K possibly damaging Het
Abcg3 A C 5: 104,938,199 C565G probably damaging Het
Actr3b G A 5: 25,829,538 V185I possibly damaging Het
Akap6 A T 12: 53,141,852 E2016D possibly damaging Het
Aldh3b2 T C 19: 3,978,662 V148A possibly damaging Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arrb1 T C 7: 99,582,297 probably benign Het
Atg2a C A 19: 6,245,067 T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 R617C possibly damaging Het
Bicra T C 7: 15,987,751 T614A possibly damaging Het
Cacna1i A G 15: 80,391,642 D167G possibly damaging Het
Calr4 T G 4: 109,246,293 probably null Het
Camsap3 G T 8: 3,603,922 E515* probably null Het
Casp8ap2 T C 4: 32,643,647 S907P probably damaging Het
Cdk19 T A 10: 40,479,780 probably benign Het
Chst14 A G 2: 118,927,015 M122V possibly damaging Het
Cntn4 A G 6: 106,675,813 M748V probably benign Het
Col7a1 A G 9: 108,978,888 D2552G unknown Het
Cpeb2 C A 5: 43,277,587 P600Q probably damaging Het
Cyp2a5 C T 7: 26,839,033 R274* probably null Het
Dexi A G 16: 10,542,518 F58S probably damaging Het
Dlg5 C A 14: 24,148,300 G1522W probably damaging Het
Dock2 T C 11: 34,294,286 H1048R probably benign Het
Dpp4 T C 2: 62,345,050 probably benign Het
Dusp10 A T 1: 184,069,180 K381N possibly damaging Het
Ercc4 A G 16: 13,147,787 E761G probably damaging Het
Ern2 T C 7: 122,183,842 probably benign Het
Fam83f A T 15: 80,692,080 T311S probably damaging Het
Fat2 T C 11: 55,262,178 D3736G probably benign Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Galntl5 C G 5: 25,198,532 S167* probably null Het
Glg1 T G 8: 111,165,674 E846D probably benign Het
Grm8 C A 6: 28,125,895 E77D probably damaging Het
Hmcn1 A T 1: 150,657,451 D3028E probably damaging Het
Htt A G 5: 34,907,085 I2943V probably benign Het
Ift80 T C 3: 68,918,513 K498R probably benign Het
Ipo9 A T 1: 135,400,146 M509K probably damaging Het
Kcnj3 T C 2: 55,437,244 V15A probably damaging Het
Kcnn3 A T 3: 89,520,455 probably benign Het
Larp1b T A 3: 40,964,084 D53E probably benign Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Maml1 A G 11: 50,266,130 L406P probably damaging Het
Mnx1 G A 5: 29,473,957 A376V unknown Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mrpl4 A G 9: 21,006,831 Y111C probably damaging Het
Mto1 T C 9: 78,461,517 probably benign Het
Nalcn A T 14: 123,316,126 M972K possibly damaging Het
Nemf T C 12: 69,346,378 I225V probably null Het
Nipal4 T G 11: 46,150,231 D379A probably damaging Het
Nktr A G 9: 121,748,866 probably benign Het
Nlrp5 A G 7: 23,404,797 T28A probably benign Het
Nxph1 T A 6: 9,247,622 Y198N probably damaging Het
Olfr1037 A T 2: 86,085,720 V19D probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1436 T C 19: 12,298,343 Y263C probably damaging Het
P2rx7 A G 5: 122,673,736 Y370C probably benign Het
Piezo1 T C 8: 122,482,645 probably benign Het
Piezo1 T C 8: 122,489,566 D1401G probably damaging Het
Plxnd1 A G 6: 115,969,363 L879P probably benign Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prss55 A T 14: 64,079,390 V101E probably benign Het
Psg26 T A 7: 18,478,425 H335L probably benign Het
Rai1 A G 11: 60,185,920 E270G probably benign Het
Reep1 A G 6: 71,780,797 N127D probably benign Het
Rims1 G T 1: 22,428,474 P769Q probably damaging Het
Robo4 A T 9: 37,404,070 probably benign Het
Ryr2 A T 13: 11,591,336 D888E probably benign Het
Scamp3 A G 3: 89,180,260 N135D probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema4f A G 6: 82,918,029 M395T probably benign Het
Sgip1 T C 4: 102,968,337 probably null Het
Sik2 A T 9: 50,995,674 probably benign Het
Smtn G T 11: 3,531,326 A223D possibly damaging Het
Spen T C 4: 141,470,343 T3405A probably benign Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Srsf11 A T 3: 158,031,580 probably benign Het
Tacc2 T G 7: 130,624,202 S891R possibly damaging Het
Tbc1d17 T A 7: 44,841,633 probably benign Het
Tgfbr3l C A 8: 4,249,600 R128S probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tlx3 T C 11: 33,203,072 S130G probably benign Het
Tmem25 A T 9: 44,798,216 probably null Het
Trak2 A T 1: 58,946,336 M1K probably null Het
Ubl3 A G 5: 148,509,280 V71A possibly damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unkl T C 17: 25,229,460 probably null Het
Uso1 T A 5: 92,201,192 S819T probably benign Het
Yes1 A T 5: 32,645,051 R103S probably damaging Het
Zfp131 A G 13: 119,767,025 V396A probably damaging Het
Zfp553 T C 7: 127,235,654 I127T possibly damaging Het
Zfp599 A T 9: 22,251,549 N102K probably benign Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Other mutations in Trappc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Trappc12 APN 12 28737836 missense probably damaging 0.99
IGL01018:Trappc12 APN 12 28691854 splice site probably benign
IGL01295:Trappc12 APN 12 28746762 missense probably damaging 1.00
IGL01365:Trappc12 APN 12 28747402 missense probably damaging 1.00
IGL01490:Trappc12 APN 12 28746915 missense probably damaging 1.00
IGL01975:Trappc12 APN 12 28692492 critical splice donor site probably null
IGL02851:Trappc12 APN 12 28691406 missense probably damaging 0.98
IGL02885:Trappc12 APN 12 28747014 missense probably benign
IGL03163:Trappc12 APN 12 28746654 missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28746752 missense probably damaging 1.00
R0102:Trappc12 UTSW 12 28746752 missense probably damaging 1.00
R0330:Trappc12 UTSW 12 28747260 missense probably benign 0.00
R0517:Trappc12 UTSW 12 28697134 splice site probably benign
R0837:Trappc12 UTSW 12 28703597 missense possibly damaging 0.92
R1439:Trappc12 UTSW 12 28747161 missense possibly damaging 0.96
R1477:Trappc12 UTSW 12 28737752 missense probably benign 0.25
R1651:Trappc12 UTSW 12 28691777 missense probably benign 0.32
R1900:Trappc12 UTSW 12 28746985 missense probably damaging 0.97
R2133:Trappc12 UTSW 12 28746598 missense probably benign 0.00
R2174:Trappc12 UTSW 12 28747381 missense possibly damaging 0.94
R4449:Trappc12 UTSW 12 28747235 missense probably benign 0.05
R5031:Trappc12 UTSW 12 28692513 missense possibly damaging 0.86
R5209:Trappc12 UTSW 12 28737794 missense probably benign 0.03
R5220:Trappc12 UTSW 12 28746697 missense probably damaging 0.97
R5458:Trappc12 UTSW 12 28746390 missense probably damaging 0.98
R5471:Trappc12 UTSW 12 28691500 missense probably damaging 1.00
R5482:Trappc12 UTSW 12 28691325 missense probably damaging 0.97
R5808:Trappc12 UTSW 12 28746864 missense probably damaging 1.00
R5916:Trappc12 UTSW 12 28691514 missense probably damaging 1.00
R5996:Trappc12 UTSW 12 28747114 missense possibly damaging 0.83
R6378:Trappc12 UTSW 12 28747083 missense probably damaging 0.97
R7669:Trappc12 UTSW 12 28711958 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- AATGTACTGAGGCTGGGACTG -3'
(R):5'- ACTCTGAGTAATGGCAGTGAAAC -3'

Sequencing Primer
(F):5'- GGTCTTGGCTGACGTCTCAC -3'
(R):5'- TGAAACCGATGGAGACGACACTC -3'
Posted On2014-07-14