Incidental Mutation 'R1900:Prex2'
ID214143
Institutional Source Beutler Lab
Gene Symbol Prex2
Ensembl Gene ENSMUSG00000048960
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
SynonymsC030045D06Rik, 6230420N16Rik, Depdc2
MMRRC Submission 039920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R1900 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location10993465-11303681 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 11162366 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 886 (E886*)
Ref Sequence ENSEMBL: ENSMUSP00000027056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027056]
Predicted Effect probably null
Transcript: ENSMUST00000027056
AA Change: E886*
SMART Domains Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960
AA Change: E886*

DomainStartEndE-ValueType
RhoGEF 19 205 8.61e-45 SMART
PH 238 355 2.43e-12 SMART
DEP 383 456 4.46e-26 SMART
DEP 484 557 6.57e-15 SMART
PDZ 593 666 9.62e-2 SMART
PDZ 677 744 6.37e-8 SMART
low complexity region 1112 1127 N/A INTRINSIC
low complexity region 1498 1507 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187694
Meta Mutation Damage Score 0.556 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,770,583 T478A probably damaging Het
6330409D20Rik T C 2: 32,740,547 probably benign Het
Ago4 T C 4: 126,516,936 I221V probably benign Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Ankrd50 T C 3: 38,455,387 T944A probably damaging Het
AU040320 A C 4: 126,853,280 probably null Het
Axdnd1 A G 1: 156,380,774 probably null Het
Cdadc1 A T 14: 59,586,532 D170E probably damaging Het
Cep164 C A 9: 45,809,825 R93L probably damaging Het
Cep250 T C 2: 155,985,374 probably null Het
Cfdp1 G A 8: 111,768,729 R286* probably null Het
Chrdl2 A G 7: 100,033,664 I377V possibly damaging Het
Cntrob A T 11: 69,308,054 S623T probably benign Het
Col6a5 C T 9: 105,931,213 G879S unknown Het
Cyp2c38 T A 19: 39,438,312 I182F probably benign Het
Dennd4a T C 9: 64,897,336 V1319A probably damaging Het
Dysf T G 6: 84,039,567 V70G probably damaging Het
Edn3 A G 2: 174,761,605 T49A possibly damaging Het
Elac1 C G 18: 73,739,245 L226F probably damaging Het
Eps8l3 A G 3: 107,890,952 D445G probably benign Het
Fam71a T A 1: 191,164,434 K4M possibly damaging Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Fstl5 T A 3: 76,708,160 W843R probably damaging Het
Fyb2 A G 4: 104,945,455 R185G probably benign Het
Gal3st2c G A 1: 94,009,044 R237H probably damaging Het
Galnt15 G T 14: 32,049,865 R289L probably damaging Het
Gdf5 T A 2: 155,942,081 D317V probably damaging Het
Gm10436 A C 12: 88,177,260 L261R probably benign Het
Gm7808 A G 9: 19,928,114 probably benign Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Hdlbp A T 1: 93,422,237 probably benign Het
Hhip T C 8: 79,975,046 T620A probably benign Het
Hs3st3a1 T C 11: 64,520,442 S269P probably damaging Het
Il17ra A T 6: 120,477,394 probably null Het
Kif2a T C 13: 106,976,995 N417S possibly damaging Het
Klhl41 T A 2: 69,674,619 probably benign Het
L3mbtl4 G T 17: 68,459,805 C169F probably damaging Het
Lap3 T C 5: 45,511,910 F467S probably damaging Het
Lpar6 A T 14: 73,239,139 Y180F probably benign Het
Lrig3 T C 10: 126,002,393 probably benign Het
Ltbp2 A T 12: 84,830,658 S378T probably damaging Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Med16 T C 10: 79,898,931 E533G probably damaging Het
Meltf T C 16: 31,881,969 probably null Het
Mphosph10 C T 7: 64,381,028 E488K possibly damaging Het
Mroh1 A G 15: 76,433,385 T812A probably benign Het
Mto1 T C 9: 78,461,517 probably benign Het
Ndst1 A T 18: 60,712,721 probably null Het
Ndst4 T A 3: 125,697,895 probably null Het
Nhlh1 A T 1: 172,054,041 I86N probably damaging Het
Nme9 A C 9: 99,459,774 D59A probably damaging Het
Nox4 A T 7: 87,360,796 R402* probably null Het
Npr1 T C 3: 90,462,188 D410G probably damaging Het
Nrip1 T A 16: 76,292,039 T877S probably benign Het
Nsd2 A G 5: 33,846,169 N221S probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1463 T A 19: 13,234,913 I221K possibly damaging Het
Olfr23 C A 11: 73,940,660 P138Q possibly damaging Het
Olfr250 A T 9: 38,368,064 I173L probably benign Het
Olfr561 A T 7: 102,775,331 H269L probably benign Het
Olfr61 A T 7: 140,638,592 D297V probably damaging Het
Olfr616 A T 7: 103,564,607 L224* probably null Het
Ophn1 A T X: 98,726,059 Y181* probably null Het
Parp1 A G 1: 180,597,339 K819R probably damaging Het
Parp9 T C 16: 35,972,221 S829P probably benign Het
Pde6c T A 19: 38,161,940 F511Y probably damaging Het
Per3 G T 4: 151,041,426 H145Q probably damaging Het
Pglyrp1 C T 7: 18,890,226 R145W probably damaging Het
Piezo1 T C 8: 122,482,645 probably benign Het
Plb1 T C 5: 32,286,847 I312T probably benign Het
Plin3 T A 17: 56,279,824 T408S possibly damaging Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prpmp5 A T 6: 132,314,698 L11Q unknown Het
Ptpn6 A G 6: 124,728,933 S83P probably benign Het
Rtp1 G T 16: 23,429,299 V41L probably benign Het
Scn4a A G 11: 106,327,533 I1035T probably damaging Het
Sell A T 1: 164,065,338 Y41F probably damaging Het
Serping1 C T 2: 84,771,449 V226M probably damaging Het
Sf3b1 A T 1: 54,998,188 D856E possibly damaging Het
Sfmbt1 T A 14: 30,802,567 Y503N probably damaging Het
Slc16a1 T A 3: 104,653,564 V395D probably damaging Het
Slc22a7 A T 17: 46,438,231 D53E probably benign Het
Slc35b3 A G 13: 38,960,611 probably null Het
Slc6a1 T C 6: 114,311,854 M274T possibly damaging Het
Slco1a5 A G 6: 142,242,063 S517P probably benign Het
Smo A G 6: 29,736,056 R16G unknown Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Sspo A G 6: 48,459,350 I1086M probably benign Het
Tas2r106 A T 6: 131,678,410 N159K probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tmeff1 T C 4: 48,658,938 probably benign Het
Tmem140 G A 6: 34,872,903 C118Y possibly damaging Het
Tmem168 A G 6: 13,583,071 C220R probably benign Het
Tox2 A T 2: 163,276,167 N129Y probably damaging Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unk T G 11: 116,059,081 D691E probably benign Het
Uox T A 3: 146,610,379 V23D probably damaging Het
Vps13d A G 4: 145,126,606 C2313R probably benign Het
Zfp804b T A 5: 6,769,283 H1260L probably damaging Het
Zfyve26 A G 12: 79,264,351 L147P probably damaging Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Zzef1 T A 11: 72,848,714 D662E probably damaging Het
Other mutations in Prex2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prex2 APN 1 11186652 missense possibly damaging 0.51
IGL00948:Prex2 APN 1 11170614 missense probably damaging 0.98
IGL01087:Prex2 APN 1 11068104 missense probably benign 0.00
IGL01490:Prex2 APN 1 11184545 splice site probably null
IGL01533:Prex2 APN 1 11186741 nonsense probably null
IGL01661:Prex2 APN 1 11208614 missense probably benign 0.01
IGL01668:Prex2 APN 1 11153645 missense probably benign 0.00
IGL01674:Prex2 APN 1 11170741 missense probably damaging 1.00
IGL01716:Prex2 APN 1 11266054 missense probably benign 0.04
IGL01867:Prex2 APN 1 11098503 missense probably benign 0.11
IGL01954:Prex2 APN 1 11140011 missense possibly damaging 0.75
IGL01990:Prex2 APN 1 11123233 splice site probably benign
IGL02022:Prex2 APN 1 11297739 missense probably benign 0.04
IGL02130:Prex2 APN 1 11112799 missense probably damaging 1.00
IGL02130:Prex2 APN 1 11160162 missense probably damaging 1.00
IGL02221:Prex2 APN 1 11061345 missense probably benign 0.00
IGL02369:Prex2 APN 1 11101169 critical splice donor site probably null
IGL02440:Prex2 APN 1 11153657 missense possibly damaging 0.94
IGL02477:Prex2 APN 1 11204154 missense probably benign
IGL02492:Prex2 APN 1 11123845 missense possibly damaging 0.93
IGL03051:Prex2 APN 1 11142665 missense probably damaging 1.00
IGL03154:Prex2 APN 1 11153633 missense possibly damaging 0.63
IGL03158:Prex2 APN 1 11266067 missense possibly damaging 0.89
IGL03308:Prex2 APN 1 11185175 missense possibly damaging 0.89
IGL03338:Prex2 APN 1 11140265 missense probably benign 0.01
R0042:Prex2 UTSW 1 11080081 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0052:Prex2 UTSW 1 11160156 missense probably damaging 1.00
R0138:Prex2 UTSW 1 11285043 splice site probably benign
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0206:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0208:Prex2 UTSW 1 11285144 missense probably damaging 1.00
R0325:Prex2 UTSW 1 11200057 splice site probably null
R0326:Prex2 UTSW 1 11285065 missense probably damaging 1.00
R0390:Prex2 UTSW 1 11089706 splice site probably null
R0492:Prex2 UTSW 1 11186633 splice site probably benign
R0512:Prex2 UTSW 1 11199933 missense probably benign
R0515:Prex2 UTSW 1 11199874 missense probably damaging 0.99
R0894:Prex2 UTSW 1 11181898 missense probably benign
R1259:Prex2 UTSW 1 11289270 missense probably damaging 1.00
R1332:Prex2 UTSW 1 11204091 missense probably damaging 1.00
R1356:Prex2 UTSW 1 11080092 nonsense probably null
R1451:Prex2 UTSW 1 11156259 missense probably benign 0.01
R1488:Prex2 UTSW 1 11193528 missense probably benign 0.05
R1512:Prex2 UTSW 1 11061330 missense possibly damaging 0.64
R1641:Prex2 UTSW 1 11231772 missense probably damaging 0.99
R1667:Prex2 UTSW 1 11186757 missense probably benign
R1678:Prex2 UTSW 1 11285089 missense possibly damaging 0.51
R1736:Prex2 UTSW 1 11089884 splice site probably benign
R1781:Prex2 UTSW 1 11199955 missense probably benign 0.17
R1804:Prex2 UTSW 1 11132342 missense probably damaging 1.00
R1836:Prex2 UTSW 1 11136780 missense probably damaging 1.00
R1899:Prex2 UTSW 1 11162366 nonsense probably null
R2020:Prex2 UTSW 1 11162312 missense probably damaging 0.98
R2114:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2117:Prex2 UTSW 1 11186713 missense probably damaging 1.00
R2436:Prex2 UTSW 1 11266152 missense possibly damaging 0.90
R2902:Prex2 UTSW 1 11208614 missense possibly damaging 0.77
R2915:Prex2 UTSW 1 11169853 missense probably damaging 1.00
R2924:Prex2 UTSW 1 11098487 missense probably damaging 1.00
R2981:Prex2 UTSW 1 11181962 missense probably damaging 1.00
R3430:Prex2 UTSW 1 11149854 missense possibly damaging 0.88
R3832:Prex2 UTSW 1 11156364 splice site probably benign
R3870:Prex2 UTSW 1 11160192 missense possibly damaging 0.86
R3963:Prex2 UTSW 1 11110357 missense possibly damaging 0.93
R4012:Prex2 UTSW 1 11184516 missense probably benign
R4030:Prex2 UTSW 1 11208568 missense probably benign 0.06
R4214:Prex2 UTSW 1 11101159 missense probably damaging 1.00
R4214:Prex2 UTSW 1 11285061 missense probably damaging 1.00
R4242:Prex2 UTSW 1 11156304 missense probably benign 0.06
R4490:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4491:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4492:Prex2 UTSW 1 11162263 missense probably benign 0.05
R4561:Prex2 UTSW 1 11184545 splice site probably null
R4624:Prex2 UTSW 1 11289265 nonsense probably null
R4647:Prex2 UTSW 1 11162285 missense probably damaging 1.00
R4657:Prex2 UTSW 1 11065825 missense probably benign 0.00
R4706:Prex2 UTSW 1 11199988 missense probably damaging 1.00
R4806:Prex2 UTSW 1 11068020 missense probably damaging 1.00
R4900:Prex2 UTSW 1 11149905 splice site probably benign
R4922:Prex2 UTSW 1 11169940 missense probably damaging 1.00
R4961:Prex2 UTSW 1 11098481 missense possibly damaging 0.75
R5284:Prex2 UTSW 1 11266090 nonsense probably null
R5305:Prex2 UTSW 1 11107678 missense probably damaging 1.00
R5307:Prex2 UTSW 1 11200032 missense probably damaging 0.99
R5331:Prex2 UTSW 1 11140011 missense possibly damaging 0.75
R5385:Prex2 UTSW 1 11139980 missense probably damaging 0.99
R5574:Prex2 UTSW 1 11140058 missense probably damaging 1.00
R5979:Prex2 UTSW 1 11132372 missense probably damaging 1.00
R6076:Prex2 UTSW 1 11185950 missense probably benign 0.09
R6160:Prex2 UTSW 1 10993851 missense probably damaging 1.00
R6177:Prex2 UTSW 1 11136777 missense possibly damaging 0.49
R6221:Prex2 UTSW 1 11266012 missense probably benign 0.01
R6293:Prex2 UTSW 1 11162298 missense probably benign
R6335:Prex2 UTSW 1 11110320 missense probably benign 0.13
R6401:Prex2 UTSW 1 11186727 missense probably benign 0.00
R6427:Prex2 UTSW 1 11182031 missense probably damaging 1.00
R6467:Prex2 UTSW 1 11266035 missense probably damaging 1.00
R6564:Prex2 UTSW 1 11101061 splice site probably null
R6734:Prex2 UTSW 1 11080059 missense probably damaging 1.00
R6753:Prex2 UTSW 1 11184456 missense probably damaging 0.98
R6880:Prex2 UTSW 1 11132384 missense probably damaging 1.00
R6973:Prex2 UTSW 1 11112743 missense probably damaging 1.00
R6980:Prex2 UTSW 1 11162263 missense probably benign 0.05
R6987:Prex2 UTSW 1 11170752 missense probably damaging 0.99
R7085:Prex2 UTSW 1 11098588 missense possibly damaging 0.73
R7101:Prex2 UTSW 1 11153609 missense possibly damaging 0.86
R7106:Prex2 UTSW 1 11136793 missense probably benign 0.33
R7319:Prex2 UTSW 1 11162308 missense probably benign 0.10
R7342:Prex2 UTSW 1 11162325 missense probably benign 0.00
R7469:Prex2 UTSW 1 11285069 missense probably damaging 1.00
R7528:Prex2 UTSW 1 11204092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGTGCTCGCATTTGAAGTCC -3'
(R):5'- ACCCCTACTTAGCCTCAAGG -3'

Sequencing Primer
(F):5'- GCTCGCATTTGAAGTCCCTTTTC -3'
(R):5'- GCCTCAAGGATTTTCTTATAGCAAC -3'
Posted On2014-07-14