Incidental Mutation 'R1900:Vps13d'
ID214173
Institutional Source Beutler Lab
Gene Symbol Vps13d
Ensembl Gene ENSMUSG00000020220
Gene Namevacuolar protein sorting 13D
Synonyms
MMRRC Submission 039920-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1900 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144972622-145195005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145126606 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 2313 (C2313R)
Ref Sequence ENSEMBL: ENSMUSP00000020441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020441] [ENSMUST00000036579]
Predicted Effect probably benign
Transcript: ENSMUST00000020441
AA Change: C2313R

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020441
Gene: ENSMUSG00000020220
AA Change: C2313R

DomainStartEndE-ValueType
Pfam:Chorein_N 2 118 1.8e-37 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
coiled coil region 665 685 N/A INTRINSIC
low complexity region 765 781 N/A INTRINSIC
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2866 2884 N/A INTRINSIC
low complexity region 2973 2983 N/A INTRINSIC
Pfam:DUF1162 3246 3530 1.1e-110 PFAM
low complexity region 3797 3810 N/A INTRINSIC
low complexity region 3913 3921 N/A INTRINSIC
low complexity region 4119 4132 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000036579
AA Change: C2319R
SMART Domains Protein: ENSMUSP00000043240
Gene: ENSMUSG00000020220
AA Change: C2319R

DomainStartEndE-ValueType
Pfam:Chorein_N 2 116 3.5e-35 PFAM
Pfam:VPS13 131 353 9.6e-57 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
Pfam:VPS13_mid_rpt 608 896 4.3e-35 PFAM
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2891 2909 N/A INTRINSIC
low complexity region 2998 3008 N/A INTRINSIC
Pfam:SHR-BD 3271 3555 4.2e-86 PFAM
low complexity region 3822 3835 N/A INTRINSIC
low complexity region 3938 3946 N/A INTRINSIC
Pfam:VPS13_C 3978 4126 4.8e-24 PFAM
low complexity region 4144 4157 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000185113
AA Change: C1140R
Meta Mutation Damage Score 0.1814 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast, vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,770,583 T478A probably damaging Het
6330409D20Rik T C 2: 32,740,547 probably benign Het
Ago4 T C 4: 126,516,936 I221V probably benign Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Ankrd50 T C 3: 38,455,387 T944A probably damaging Het
AU040320 A C 4: 126,853,280 probably null Het
Axdnd1 A G 1: 156,380,774 probably null Het
Cdadc1 A T 14: 59,586,532 D170E probably damaging Het
Cep164 C A 9: 45,809,825 R93L probably damaging Het
Cep250 T C 2: 155,985,374 probably null Het
Cfdp1 G A 8: 111,768,729 R286* probably null Het
Chrdl2 A G 7: 100,033,664 I377V possibly damaging Het
Cntrob A T 11: 69,308,054 S623T probably benign Het
Col6a5 C T 9: 105,931,213 G879S unknown Het
Cyp2c38 T A 19: 39,438,312 I182F probably benign Het
Dennd4a T C 9: 64,897,336 V1319A probably damaging Het
Dysf T G 6: 84,039,567 V70G probably damaging Het
Edn3 A G 2: 174,761,605 T49A possibly damaging Het
Elac1 C G 18: 73,739,245 L226F probably damaging Het
Eps8l3 A G 3: 107,890,952 D445G probably benign Het
Fam71a T A 1: 191,164,434 K4M possibly damaging Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Fstl5 T A 3: 76,708,160 W843R probably damaging Het
Fyb2 A G 4: 104,945,455 R185G probably benign Het
Gal3st2c G A 1: 94,009,044 R237H probably damaging Het
Galnt15 G T 14: 32,049,865 R289L probably damaging Het
Gdf5 T A 2: 155,942,081 D317V probably damaging Het
Gm10436 A C 12: 88,177,260 L261R probably benign Het
Gm7808 A G 9: 19,928,114 probably benign Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Hdlbp A T 1: 93,422,237 probably benign Het
Hhip T C 8: 79,975,046 T620A probably benign Het
Hs3st3a1 T C 11: 64,520,442 S269P probably damaging Het
Il17ra A T 6: 120,477,394 probably null Het
Kif2a T C 13: 106,976,995 N417S possibly damaging Het
Klhl41 T A 2: 69,674,619 probably benign Het
L3mbtl4 G T 17: 68,459,805 C169F probably damaging Het
Lap3 T C 5: 45,511,910 F467S probably damaging Het
Lpar6 A T 14: 73,239,139 Y180F probably benign Het
Lrig3 T C 10: 126,002,393 probably benign Het
Ltbp2 A T 12: 84,830,658 S378T probably damaging Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Med16 T C 10: 79,898,931 E533G probably damaging Het
Meltf T C 16: 31,881,969 probably null Het
Mphosph10 C T 7: 64,381,028 E488K possibly damaging Het
Mroh1 A G 15: 76,433,385 T812A probably benign Het
Mto1 T C 9: 78,461,517 probably benign Het
Ndst1 A T 18: 60,712,721 probably null Het
Ndst4 T A 3: 125,697,895 probably null Het
Nhlh1 A T 1: 172,054,041 I86N probably damaging Het
Nme9 A C 9: 99,459,774 D59A probably damaging Het
Nox4 A T 7: 87,360,796 R402* probably null Het
Npr1 T C 3: 90,462,188 D410G probably damaging Het
Nrip1 T A 16: 76,292,039 T877S probably benign Het
Nsd2 A G 5: 33,846,169 N221S probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1463 T A 19: 13,234,913 I221K possibly damaging Het
Olfr23 C A 11: 73,940,660 P138Q possibly damaging Het
Olfr250 A T 9: 38,368,064 I173L probably benign Het
Olfr561 A T 7: 102,775,331 H269L probably benign Het
Olfr61 A T 7: 140,638,592 D297V probably damaging Het
Olfr616 A T 7: 103,564,607 L224* probably null Het
Ophn1 A T X: 98,726,059 Y181* probably null Het
Parp1 A G 1: 180,597,339 K819R probably damaging Het
Parp9 T C 16: 35,972,221 S829P probably benign Het
Pde6c T A 19: 38,161,940 F511Y probably damaging Het
Per3 G T 4: 151,041,426 H145Q probably damaging Het
Pglyrp1 C T 7: 18,890,226 R145W probably damaging Het
Piezo1 T C 8: 122,482,645 probably benign Het
Plb1 T C 5: 32,286,847 I312T probably benign Het
Plin3 T A 17: 56,279,824 T408S possibly damaging Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prpmp5 A T 6: 132,314,698 L11Q unknown Het
Ptpn6 A G 6: 124,728,933 S83P probably benign Het
Rtp1 G T 16: 23,429,299 V41L probably benign Het
Scn4a A G 11: 106,327,533 I1035T probably damaging Het
Sell A T 1: 164,065,338 Y41F probably damaging Het
Serping1 C T 2: 84,771,449 V226M probably damaging Het
Sf3b1 A T 1: 54,998,188 D856E possibly damaging Het
Sfmbt1 T A 14: 30,802,567 Y503N probably damaging Het
Slc16a1 T A 3: 104,653,564 V395D probably damaging Het
Slc22a7 A T 17: 46,438,231 D53E probably benign Het
Slc35b3 A G 13: 38,960,611 probably null Het
Slc6a1 T C 6: 114,311,854 M274T possibly damaging Het
Slco1a5 A G 6: 142,242,063 S517P probably benign Het
Smo A G 6: 29,736,056 R16G unknown Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Sspo A G 6: 48,459,350 I1086M probably benign Het
Tas2r106 A T 6: 131,678,410 N159K probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tmeff1 T C 4: 48,658,938 probably benign Het
Tmem140 G A 6: 34,872,903 C118Y possibly damaging Het
Tmem168 A G 6: 13,583,071 C220R probably benign Het
Tox2 A T 2: 163,276,167 N129Y probably damaging Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unk T G 11: 116,059,081 D691E probably benign Het
Uox T A 3: 146,610,379 V23D probably damaging Het
Zfp804b T A 5: 6,769,283 H1260L probably damaging Het
Zfyve26 A G 12: 79,264,351 L147P probably damaging Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Zzef1 T A 11: 72,848,714 D662E probably damaging Het
Other mutations in Vps13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vps13d APN 4 145168540 missense probably damaging 0.98
IGL00484:Vps13d APN 4 145126575 missense probably benign 0.04
IGL00591:Vps13d APN 4 145190559 missense possibly damaging 0.95
IGL00816:Vps13d APN 4 145155994 missense probably benign 0.00
IGL00835:Vps13d APN 4 145160652 missense probably damaging 0.97
IGL00847:Vps13d APN 4 145085408 missense probably benign 0.26
IGL01084:Vps13d APN 4 145154955 missense probably benign 0.00
IGL01116:Vps13d APN 4 144972750 unclassified probably benign
IGL01150:Vps13d APN 4 145149275 missense probably benign
IGL01329:Vps13d APN 4 145156206 missense possibly damaging 0.69
IGL01338:Vps13d APN 4 145088322 missense probably damaging 1.00
IGL01583:Vps13d APN 4 145045088 missense probably damaging 1.00
IGL01598:Vps13d APN 4 145016901 missense probably benign 0.21
IGL01620:Vps13d APN 4 145094867 missense possibly damaging 0.70
IGL01636:Vps13d APN 4 145075048 missense probably damaging 1.00
IGL01723:Vps13d APN 4 145173145 missense possibly damaging 0.84
IGL01895:Vps13d APN 4 145156266 missense possibly damaging 0.57
IGL01981:Vps13d APN 4 145086747 missense probably damaging 0.99
IGL02192:Vps13d APN 4 145148858 missense probably benign 0.02
IGL02197:Vps13d APN 4 145128309 missense probably benign 0.01
IGL02209:Vps13d APN 4 145156101 missense probably damaging 0.97
IGL02219:Vps13d APN 4 145168146 missense probably benign 0.00
IGL02377:Vps13d APN 4 145156364 missense probably damaging 1.00
IGL02404:Vps13d APN 4 145148735 missense probably damaging 1.00
IGL02552:Vps13d APN 4 145173137 missense possibly damaging 0.46
IGL02651:Vps13d APN 4 145164559 missense probably benign 0.02
IGL02708:Vps13d APN 4 145128280 missense probably benign 0.12
IGL02811:Vps13d APN 4 145131765 missense possibly damaging 0.55
IGL02821:Vps13d APN 4 145148762 missense probably damaging 0.98
IGL02838:Vps13d APN 4 145075025 missense probably benign 0.31
IGL02968:Vps13d APN 4 145122498 missense probably benign 0.32
IGL03176:Vps13d APN 4 145074963 missense probably benign 0.16
IGL03352:Vps13d APN 4 145167502 missense possibly damaging 0.49
IGL03374:Vps13d APN 4 145108575 missense possibly damaging 0.70
IGL03375:Vps13d APN 4 145091947 missense probably damaging 1.00
IGL03383:Vps13d APN 4 145168319 critical splice acceptor site probably null
IGL03411:Vps13d APN 4 145149324 missense probably damaging 1.00
PIT4283001:Vps13d UTSW 4 145108588 missense
PIT4434001:Vps13d UTSW 4 145155247 missense
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0076:Vps13d UTSW 4 145164694 splice site probably benign
R0211:Vps13d UTSW 4 145114778 missense probably benign 0.08
R0219:Vps13d UTSW 4 145105909 missense probably benign 0.01
R0284:Vps13d UTSW 4 145144802 missense probably benign 0.01
R0345:Vps13d UTSW 4 145117625 missense possibly damaging 0.81
R0400:Vps13d UTSW 4 145065827 missense probably benign 0.00
R0417:Vps13d UTSW 4 144976560 missense probably benign 0.19
R0538:Vps13d UTSW 4 145045095 missense probably damaging 1.00
R0560:Vps13d UTSW 4 145054190 missense probably damaging 1.00
R0627:Vps13d UTSW 4 145087184 missense probably damaging 1.00
R0707:Vps13d UTSW 4 145155932 missense probably damaging 1.00
R0782:Vps13d UTSW 4 145126625 splice site probably benign
R0925:Vps13d UTSW 4 145156551 missense probably damaging 1.00
R0993:Vps13d UTSW 4 145117692 nonsense probably null
R1135:Vps13d UTSW 4 145155589 missense probably benign 0.01
R1165:Vps13d UTSW 4 145126471 missense probably benign
R1263:Vps13d UTSW 4 145170348 missense probably benign 0.01
R1397:Vps13d UTSW 4 145141334 missense probably damaging 1.00
R1398:Vps13d UTSW 4 145099983 missense probably null
R1521:Vps13d UTSW 4 145105861 missense probably benign 0.00
R1522:Vps13d UTSW 4 145098172 splice site probably null
R1725:Vps13d UTSW 4 145143260 missense possibly damaging 0.90
R1759:Vps13d UTSW 4 145155857 missense probably benign
R1826:Vps13d UTSW 4 145155003 missense probably damaging 0.96
R1943:Vps13d UTSW 4 145155857 missense probably benign
R1955:Vps13d UTSW 4 145156143 missense probably damaging 1.00
R2008:Vps13d UTSW 4 145155243 missense probably benign 0.00
R2013:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2014:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2038:Vps13d UTSW 4 145181115 critical splice donor site probably null
R2108:Vps13d UTSW 4 145075047 missense probably damaging 0.99
R2130:Vps13d UTSW 4 145156101 missense probably benign 0.17
R2134:Vps13d UTSW 4 145148339 missense probably benign 0.00
R2168:Vps13d UTSW 4 145087323 splice site probably benign
R2220:Vps13d UTSW 4 145178320 missense probably damaging 1.00
R2240:Vps13d UTSW 4 145110895 missense possibly damaging 0.70
R2332:Vps13d UTSW 4 145148686 missense probably benign
R2357:Vps13d UTSW 4 145074977 frame shift probably null
R2365:Vps13d UTSW 4 145087324 splice site probably benign
R2571:Vps13d UTSW 4 145149136 missense probably benign 0.20
R3149:Vps13d UTSW 4 145126577 missense possibly damaging 0.70
R3150:Vps13d UTSW 4 145086790 missense probably damaging 0.98
R3547:Vps13d UTSW 4 145074975 missense probably damaging 0.99
R3716:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3718:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3725:Vps13d UTSW 4 145115648 splice site probably benign
R3794:Vps13d UTSW 4 145085437 splice site probably benign
R3875:Vps13d UTSW 4 145190544 missense probably damaging 1.00
R3948:Vps13d UTSW 4 145141340 missense probably damaging 1.00
R3953:Vps13d UTSW 4 145148880 missense probably damaging 1.00
R4021:Vps13d UTSW 4 145075061 missense possibly damaging 0.90
R4323:Vps13d UTSW 4 145152778 missense probably benign 0.28
R4346:Vps13d UTSW 4 145072529 intron probably benign
R4509:Vps13d UTSW 4 145062602 missense probably damaging 1.00
R4613:Vps13d UTSW 4 145131655 missense possibly damaging 0.95
R4657:Vps13d UTSW 4 145074842 missense probably damaging 1.00
R4680:Vps13d UTSW 4 145108510 missense possibly damaging 0.94
R4688:Vps13d UTSW 4 145178212 missense probably benign
R4797:Vps13d UTSW 4 145054155 missense probably damaging 1.00
R4798:Vps13d UTSW 4 145178056 missense probably damaging 0.98
R4817:Vps13d UTSW 4 145069165 missense probably damaging 1.00
R4839:Vps13d UTSW 4 145085430 missense possibly damaging 0.95
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4869:Vps13d UTSW 4 145128042 missense probably damaging 1.00
R4904:Vps13d UTSW 4 145155445 missense probably damaging 1.00
R4912:Vps13d UTSW 4 145155857 missense probably benign
R4916:Vps13d UTSW 4 144983393 missense probably damaging 1.00
R4976:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5029:Vps13d UTSW 4 145156282 missense probably benign 0.02
R5049:Vps13d UTSW 4 145086766 missense probably damaging 1.00
R5077:Vps13d UTSW 4 145088241 missense probably damaging 0.98
R5119:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5227:Vps13d UTSW 4 145181207 splice site probably null
R5291:Vps13d UTSW 4 145062569 missense probably damaging 0.99
R5344:Vps13d UTSW 4 145178334 missense probably damaging 0.98
R5348:Vps13d UTSW 4 145065889 missense probably damaging 0.99
R5478:Vps13d UTSW 4 145167550 missense probably damaging 0.99
R5632:Vps13d UTSW 4 145074882 missense probably damaging 0.99
R5642:Vps13d UTSW 4 145170302 missense possibly damaging 0.66
R5712:Vps13d UTSW 4 145087173 missense probably benign 0.07
R5747:Vps13d UTSW 4 145168283 missense probably benign 0.00
R5752:Vps13d UTSW 4 145148970 missense probably benign 0.06
R5804:Vps13d UTSW 4 145100070 missense probably benign 0.03
R5917:Vps13d UTSW 4 145100010 missense probably damaging 0.96
R5932:Vps13d UTSW 4 145045041 missense possibly damaging 0.71
R5940:Vps13d UTSW 4 145074975 missense probably benign 0.09
R5978:Vps13d UTSW 4 145122611 missense probably benign
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6143:Vps13d UTSW 4 145148565 missense possibly damaging 0.95
R6174:Vps13d UTSW 4 144975193 nonsense probably null
R6191:Vps13d UTSW 4 145149348 missense probably damaging 1.00
R6198:Vps13d UTSW 4 145148990 missense probably benign 0.28
R6374:Vps13d UTSW 4 145122681 missense probably damaging 1.00
R6379:Vps13d UTSW 4 145088258 missense probably benign
R6388:Vps13d UTSW 4 145155574 missense probably benign 0.06
R6418:Vps13d UTSW 4 145092280 missense probably damaging 0.98
R6466:Vps13d UTSW 4 145057495 missense possibly damaging 0.47
R6602:Vps13d UTSW 4 145103664 intron probably benign
R6604:Vps13d UTSW 4 145181124 missense probably damaging 1.00
R7051:Vps13d UTSW 4 145163344 missense probably benign 0.00
R7052:Vps13d UTSW 4 145163344 missense probably benign 0.00
R7103:Vps13d UTSW 4 145115492 missense
R7231:Vps13d UTSW 4 145057462 missense
R7246:Vps13d UTSW 4 145156050 missense
R7339:Vps13d UTSW 4 145121368 missense
R7409:Vps13d UTSW 4 145141254 missense
R7419:Vps13d UTSW 4 145115503 missense
R7424:Vps13d UTSW 4 145148747 missense
R7439:Vps13d UTSW 4 145105856 missense
R7440:Vps13d UTSW 4 145128411 missense
R7528:Vps13d UTSW 4 145091922 missense
R7547:Vps13d UTSW 4 145057538 missense
R7558:Vps13d UTSW 4 145154580 missense
R7729:Vps13d UTSW 4 145075052 missense
R7789:Vps13d UTSW 4 145100065 missense
R7813:Vps13d UTSW 4 145178063 nonsense probably null
R7834:Vps13d UTSW 4 145108573 missense
R7840:Vps13d UTSW 4 145103676 missense
R7880:Vps13d UTSW 4 145181114 critical splice donor site probably null
R7912:Vps13d UTSW 4 145173127 missense
R7917:Vps13d UTSW 4 145108573 missense
R7923:Vps13d UTSW 4 145103676 missense
R7963:Vps13d UTSW 4 145181114 critical splice donor site probably null
R7993:Vps13d UTSW 4 145173127 missense
R8021:Vps13d UTSW 4 145148675 missense
R8048:Vps13d UTSW 4 145155567 missense
R8057:Vps13d UTSW 4 144975183 missense
R8063:Vps13d UTSW 4 145114757 missense
X0021:Vps13d UTSW 4 145155025 missense probably damaging 0.99
Z1176:Vps13d UTSW 4 145107067 missense
Z1177:Vps13d UTSW 4 145154908 missense
Z1177:Vps13d UTSW 4 145178296 missense
Predicted Primers PCR Primer
(F):5'- ATGCAGTTCAATCTGAATGGAGC -3'
(R):5'- CCTCTCTGCGATTGGAAAGG -3'

Sequencing Primer
(F):5'- TCAATCTGAATGGAGCCCTGG -3'
(R):5'- CGATTGGAAAGGTTTCAGGCCC -3'
Posted On2014-07-14