Mutagenetix > Incidental Mutation

Incidental Mutation 'R1900:Dysf'

214184

Institutional Source

Beutler Lab

Gene Symbol

Dysf

Ensembl Gene

ENSMUSG00000033788

Gene Name

dysferlin

Synonyms

2310004N10Rik

MMRRC Submission

039920-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1900 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84008590-84211060 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 84039567 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 70 (V70G)

Ref Sequence

ENSEMBL: ENSMUSP00000144748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081904] [ENSMUST00000089595] [ENSMUST00000113818] [ENSMUST00000113821] [ENSMUST00000113823] [ENSMUST00000153860] [ENSMUST00000168387] [ENSMUST00000203695] [ENSMUST00000203803] [ENSMUST00000204354] [ENSMUST00000204987] [ENSMUST00000204591]

AlphaFold

Q9ESD7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081904
AA Change: V70G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000080579
Gene: ENSMUSG00000033788
AA Change: V70G

Domain	Start	End	E-Value	Type
C2	1	101	2.11e-14	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	213	232	N/A	INTRINSIC
C2	255	351	4.84e-14	SMART
FerI	337	408	5.3e-39	SMART
C2	414	528	2.96e-9	SMART
FerA	714	779	6.3e-23	SMART
FerB	806	880	2.49e-44	SMART
DysFN	894	953	1.42e-22	SMART
DysFN	966	1022	2.65e-22	SMART
DysFC	1031	1069	1.33e-13	SMART
DysFC	1088	1121	1.1e-10	SMART
C2	1173	1281	2.63e-15	SMART
C2	1350	1457	7.13e0	SMART
C2	1599	1698	2.52e-12	SMART
C2	1832	1961	1.55e-3	SMART
Pfam:Ferlin_C	1991	2095	6.7e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089595
AA Change: V70G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087022
Gene: ENSMUSG00000033788
AA Change: V70G

Domain	Start	End	E-Value	Type
C2	1	101	2.11e-14	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	182	201	N/A	INTRINSIC
C2	224	320	4.84e-14	SMART
FerI	306	377	5.3e-39	SMART
C2	383	497	1.12e-9	SMART
FerA	697	762	6.3e-23	SMART
FerB	789	863	2.49e-44	SMART
DysFN	877	936	1.42e-22	SMART
DysFN	949	1005	2.65e-22	SMART
DysFC	1014	1052	1.33e-13	SMART
DysFC	1071	1104	1.1e-10	SMART
C2	1156	1264	2.63e-15	SMART
C2	1333	1440	7.13e0	SMART
C2	1582	1681	2.52e-12	SMART
C2	1815	1944	1.55e-3	SMART
Pfam:Ferlin_C	1974	2078	3.7e-25	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113818
AA Change: V70G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109449
Gene: ENSMUSG00000033788
AA Change: V70G

Domain	Start	End	E-Value	Type
C2	1	101	2.11e-14	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	182	201	N/A	INTRINSIC
C2	224	320	4.84e-14	SMART
FerI	306	377	5.3e-39	SMART
C2	383	497	2.96e-9	SMART
FerA	683	748	6.3e-23	SMART
FerB	775	849	2.49e-44	SMART
DysFN	863	922	1.42e-22	SMART
DysFN	935	991	2.65e-22	SMART
DysFC	1000	1038	1.33e-13	SMART
DysFC	1057	1090	1.1e-10	SMART
C2	1142	1250	2.63e-15	SMART
C2	1319	1426	7.13e0	SMART
C2	1568	1667	2.52e-12	SMART
C2	1801	1930	1.55e-3	SMART
transmembrane domain	2034	2056	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113821
AA Change: V69G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109452
Gene: ENSMUSG00000033788
AA Change: V69G

Domain	Start	End	E-Value	Type
C2	1	100	1.62e-15	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	181	200	N/A	INTRINSIC
C2	223	319	4.84e-14	SMART
FerI	305	376	5.3e-39	SMART
C2	382	496	1.12e-9	SMART
FerA	696	761	6.3e-23	SMART
FerB	788	862	2.49e-44	SMART
DysFN	876	935	1.42e-22	SMART
DysFN	948	1004	2.65e-22	SMART
DysFC	1013	1051	1.33e-13	SMART
DysFC	1070	1103	1.1e-10	SMART
C2	1155	1263	2.63e-15	SMART
C2	1332	1439	7.13e0	SMART
C2	1581	1680	2.52e-12	SMART
C2	1814	1943	1.55e-3	SMART
transmembrane domain	2047	2069	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113823
AA Change: V69G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000109454
Gene: ENSMUSG00000033788
AA Change: V69G

Domain	Start	End	E-Value	Type
C2	1	100	1.62e-15	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	212	231	N/A	INTRINSIC
C2	254	350	4.84e-14	SMART
FerI	336	407	5.3e-39	SMART
C2	413	527	2.96e-9	SMART
FerA	713	778	6.3e-23	SMART
FerB	805	879	2.49e-44	SMART
DysFN	893	952	1.42e-22	SMART
DysFN	965	1021	2.65e-22	SMART
DysFC	1030	1068	1.33e-13	SMART
DysFC	1087	1120	1.1e-10	SMART
C2	1172	1280	2.63e-15	SMART
C2	1349	1456	7.13e0	SMART
C2	1598	1697	2.52e-12	SMART
C2	1831	1960	1.55e-3	SMART
transmembrane domain	2064	2086	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153860
AA Change: V69G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000145518
Gene: ENSMUSG00000033788
AA Change: V69G

Domain	Start	End	E-Value	Type
C2	1	100	1.1e-17	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	181	200	N/A	INTRINSIC
C2	223	319	3.2e-16	SMART
FerI	305	376	2.6e-43	SMART
C2	382	496	7.4e-12	SMART
FerA	696	761	3.1e-27	SMART
FerB	788	862	1.2e-48	SMART
DysFN	876	935	5.3e-25	SMART
DysFN	948	1004	9.6e-25	SMART
DysFC	1013	1051	4.7e-16	SMART
DysFC	1070	1103	4.1e-13	SMART
C2	1155	1263	1.7e-17	SMART
C2	1332	1439	4.7e-2	SMART
C2	1602	1701	1.7e-14	SMART
C2	1835	1964	1.1e-5	SMART
Pfam:Ferlin_C	1994	2098	4.4e-22	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168387
AA Change: V69G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000132297
Gene: ENSMUSG00000033788
AA Change: V69G

Domain	Start	End	E-Value	Type
C2	1	100	1.62e-15	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	181	200	N/A	INTRINSIC
C2	223	319	4.84e-14	SMART
FerI	305	376	5.3e-39	SMART
C2	382	496	1.12e-9	SMART
FerA	704	769	6.3e-23	SMART
FerB	796	870	2.49e-44	SMART
DysFN	884	943	1.42e-22	SMART
DysFN	956	1012	2.65e-22	SMART
DysFC	1021	1059	1.33e-13	SMART
DysFC	1078	1111	1.1e-10	SMART
C2	1163	1271	2.63e-15	SMART
C2	1340	1447	7.13e0	SMART
C2	1589	1688	2.52e-12	SMART
C2	1822	1951	1.55e-3	SMART
transmembrane domain	2055	2077	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203695
AA Change: V70G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000145292
Gene: ENSMUSG00000033788
AA Change: V70G

Domain	Start	End	E-Value	Type
C2	1	101	1.4e-16	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	213	232	N/A	INTRINSIC
C2	255	351	3.2e-16	SMART
FerI	337	408	2.6e-43	SMART
C2	414	528	7.4e-12	SMART
FerA	728	793	3.1e-27	SMART
FerB	820	894	1.2e-48	SMART
DysFN	908	967	5.3e-25	SMART
DysFN	980	1036	9.6e-25	SMART
DysFC	1045	1083	4.7e-16	SMART
DysFC	1102	1135	4.1e-13	SMART
C2	1187	1295	1.7e-17	SMART
C2	1364	1471	4.7e-2	SMART
C2	1613	1712	1.7e-14	SMART
C2	1846	1975	1.1e-5	SMART
Pfam:Ferlin_C	2005	2109	4.4e-22	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203803
AA Change: V69G

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000145511
Gene: ENSMUSG00000033788
AA Change: V69G

Domain	Start	End	E-Value	Type
C2	1	100	1.1e-17	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	212	231	N/A	INTRINSIC
C2	254	350	3.2e-16	SMART
FerI	336	407	2.6e-43	SMART
C2	413	527	7.4e-12	SMART
FerA	727	792	3.1e-27	SMART
FerB	819	893	1.2e-48	SMART
DysFN	907	966	5.3e-25	SMART
DysFN	979	1035	9.6e-25	SMART
DysFC	1044	1082	4.7e-16	SMART
DysFC	1101	1134	4.1e-13	SMART
C2	1186	1294	1.7e-17	SMART
C2	1353	1460	4.7e-2	SMART
C2	1602	1701	1.7e-14	SMART
C2	1835	1964	1.1e-5	SMART
Pfam:Ferlin_C	1994	2098	4.4e-22	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204354
AA Change: V70G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144705
Gene: ENSMUSG00000033788
AA Change: V70G

Domain	Start	End	E-Value	Type
C2	1	101	1.4e-16	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	182	201	N/A	INTRINSIC
C2	224	320	3.2e-16	SMART
FerI	306	377	2.6e-43	SMART
C2	383	497	2e-11	SMART
FerA	683	748	3.1e-27	SMART
FerB	775	849	1.2e-48	SMART
DysFN	863	922	5.3e-25	SMART
DysFN	935	991	9.6e-25	SMART
DysFC	1000	1038	4.7e-16	SMART
DysFC	1057	1090	4.1e-13	SMART
C2	1142	1250	1.7e-17	SMART
C2	1319	1426	4.7e-2	SMART
C2	1589	1688	1.7e-14	SMART
C2	1822	1951	1.1e-5	SMART
Pfam:Ferlin_C	1981	2085	4.4e-22	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000204987
AA Change: V70G

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000144748
Gene: ENSMUSG00000033788
AA Change: V70G

Domain	Start	End	E-Value	Type
C2	1	101	1.4e-16	SMART
low complexity region	126	147	N/A	INTRINSIC
low complexity region	182	201	N/A	INTRINSIC
C2	224	320	3.2e-16	SMART
FerI	306	377	2.6e-43	SMART
C2	383	497	7.4e-12	SMART
FerA	697	762	3.1e-27	SMART
FerB	789	863	1.2e-48	SMART
DysFN	877	936	5.3e-25	SMART
DysFN	949	1005	9.6e-25	SMART
DysFC	1014	1052	4.7e-16	SMART
DysFC	1071	1104	4.1e-13	SMART
C2	1156	1264	1.7e-17	SMART
C2	1333	1440	4.7e-2	SMART
C2	1603	1702	1.7e-14	SMART
C2	1836	1965	1.1e-5	SMART
Pfam:Ferlin_C	1995	2099	4.4e-22	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204591
AA Change: V69G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144970
Gene: ENSMUSG00000033788
AA Change: V69G

Domain	Start	End	E-Value	Type
C2	1	100	1.1e-17	SMART
low complexity region	125	146	N/A	INTRINSIC
low complexity region	212	231	N/A	INTRINSIC
C2	254	350	3.2e-16	SMART
FerI	336	407	2.6e-43	SMART
C2	413	527	2e-11	SMART
FerA	713	778	3.1e-27	SMART
FerB	805	879	1.2e-48	SMART
DysFN	893	952	5.3e-25	SMART
DysFN	965	1021	9.6e-25	SMART
DysFC	1030	1068	4.7e-16	SMART
DysFC	1087	1120	4.1e-13	SMART
C2	1172	1280	1.7e-17	SMART
C2	1349	1456	4.7e-2	SMART
C2	1619	1718	1.7e-14	SMART
C2	1852	1981	1.1e-5	SMART
Pfam:Ferlin_C	2011	2115	4.4e-22	PFAM

Meta Mutation Damage Score

0.9452

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 93.0%

Validation Efficiency

96% (100/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ferlin family and is a skeletal muscle protein found associated with the sarcolemma. It is involved in muscle contraction and contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. In addition, the protein encoded by this gene binds caveolin-3, a skeletal muscle membrane protein which is important in the formation of caveolae. Specific mutations in this gene have been shown to cause autosomal recessive limb girdle muscular dystrophy type 2B (LGMD2B) as well as Miyoshi myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes display dystrophic muscle changes and progressive muscle weakness developing over time. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	C	14: 49,770,583	T478A	probably damaging	Het
6330409D20Rik	T	C	2: 32,740,547		probably benign	Het
Ago4	T	C	4: 126,516,936	I221V	probably benign	Het
Ankfy1	C	T	11: 72,754,407	Q771*	probably null	Het
Ankrd50	T	C	3: 38,455,387	T944A	probably damaging	Het
AU040320	A	C	4: 126,853,280		probably null	Het
Axdnd1	A	G	1: 156,380,774		probably null	Het
Cdadc1	A	T	14: 59,586,532	D170E	probably damaging	Het
Cep164	C	A	9: 45,809,825	R93L	probably damaging	Het
Cep250	T	C	2: 155,985,374		probably null	Het
Cfdp1	G	A	8: 111,768,729	R286*	probably null	Het
Chrdl2	A	G	7: 100,033,664	I377V	possibly damaging	Het
Cntrob	A	T	11: 69,308,054	S623T	probably benign	Het
Col6a5	C	T	9: 105,931,213	G879S	unknown	Het
Cyp2c38	T	A	19: 39,438,312	I182F	probably benign	Het
Dennd4a	T	C	9: 64,897,336	V1319A	probably damaging	Het
Edn3	A	G	2: 174,761,605	T49A	possibly damaging	Het
Elac1	C	G	18: 73,739,245	L226F	probably damaging	Het
Eps8l3	A	G	3: 107,890,952	D445G	probably benign	Het
Fam71a	T	A	1: 191,164,434	K4M	possibly damaging	Het
Fgf11	G	T	11: 69,801,453	T58K	probably benign	Het
Fstl5	T	A	3: 76,708,160	W843R	probably damaging	Het
Fyb2	A	G	4: 104,945,455	R185G	probably benign	Het
Gal3st2c	G	A	1: 94,009,044	R237H	probably damaging	Het
Galnt15	G	T	14: 32,049,865	R289L	probably damaging	Het
Gdf5	T	A	2: 155,942,081	D317V	probably damaging	Het
Gm10436	A	C	12: 88,177,260	L261R	probably benign	Het
Gm7808	A	G	9: 19,928,114		probably benign	Het
Hcn3	T	C	3: 89,148,263	E559G	probably benign	Het
Hdlbp	A	T	1: 93,422,237		probably benign	Het
Hhip	T	C	8: 79,975,046	T620A	probably benign	Het
Hs3st3a1	T	C	11: 64,520,442	S269P	probably damaging	Het
Il17ra	A	T	6: 120,477,394		probably null	Het
Kif2a	T	C	13: 106,976,995	N417S	possibly damaging	Het
Klhl41	T	A	2: 69,674,619		probably benign	Het
L3mbtl4	G	T	17: 68,459,805	C169F	probably damaging	Het
Lap3	T	C	5: 45,511,910	F467S	probably damaging	Het
Lpar6	A	T	14: 73,239,139	Y180F	probably benign	Het
Lrig3	T	C	10: 126,002,393		probably benign	Het
Ltbp2	A	T	12: 84,830,658	S378T	probably damaging	Het
Ltf	T	C	9: 111,022,845	F117L	possibly damaging	Het
Med16	T	C	10: 79,898,931	E533G	probably damaging	Het
Meltf	T	C	16: 31,881,969		probably null	Het
Mphosph10	C	T	7: 64,381,028	E488K	possibly damaging	Het
Mroh1	A	G	15: 76,433,385	T812A	probably benign	Het
Mto1	T	C	9: 78,461,517		probably benign	Het
Ndst1	A	T	18: 60,712,721		probably null	Het
Ndst4	T	A	3: 125,697,895		probably null	Het
Nhlh1	A	T	1: 172,054,041	I86N	probably damaging	Het
Nme9	A	C	9: 99,459,774	D59A	probably damaging	Het
Nox4	A	T	7: 87,360,796	R402*	probably null	Het
Npr1	T	C	3: 90,462,188	D410G	probably damaging	Het
Nrip1	T	A	16: 76,292,039	T877S	probably benign	Het
Nsd2	A	G	5: 33,846,169	N221S	probably benign	Het
Olfr1230	T	C	2: 89,296,670	N200S	probably damaging	Het
Olfr1463	T	A	19: 13,234,913	I221K	possibly damaging	Het
Olfr23	C	A	11: 73,940,660	P138Q	possibly damaging	Het
Olfr250	A	T	9: 38,368,064	I173L	probably benign	Het
Olfr561	A	T	7: 102,775,331	H269L	probably benign	Het
Olfr61	A	T	7: 140,638,592	D297V	probably damaging	Het
Olfr616	A	T	7: 103,564,607	L224*	probably null	Het
Ophn1	A	T	X: 98,726,059	Y181*	probably null	Het
Parp1	A	G	1: 180,597,339	K819R	probably damaging	Het
Parp9	T	C	16: 35,972,221	S829P	probably benign	Het
Pde6c	T	A	19: 38,161,940	F511Y	probably damaging	Het
Per3	G	T	4: 151,041,426	H145Q	probably damaging	Het
Pglyrp1	C	T	7: 18,890,226	R145W	probably damaging	Het
Piezo1	T	C	8: 122,482,645		probably benign	Het
Plb1	T	C	5: 32,286,847	I312T	probably benign	Het
Plin3	T	A	17: 56,279,824	T408S	possibly damaging	Het
Polr2a	A	T	11: 69,743,946	I636N	probably damaging	Het
Prex2	G	T	1: 11,162,366	E886*	probably null	Het
Proca1	A	T	11: 78,205,021	I73F	probably damaging	Het
Prpmp5	A	T	6: 132,314,698	L11Q	unknown	Het
Ptpn6	A	G	6: 124,728,933	S83P	probably benign	Het
Rtp1	G	T	16: 23,429,299	V41L	probably benign	Het
Scn4a	A	G	11: 106,327,533	I1035T	probably damaging	Het
Sell	A	T	1: 164,065,338	Y41F	probably damaging	Het
Serping1	C	T	2: 84,771,449	V226M	probably damaging	Het
Sf3b1	A	T	1: 54,998,188	D856E	possibly damaging	Het
Sfmbt1	T	A	14: 30,802,567	Y503N	probably damaging	Het
Slc16a1	T	A	3: 104,653,564	V395D	probably damaging	Het
Slc22a7	A	T	17: 46,438,231	D53E	probably benign	Het
Slc35b3	A	G	13: 38,960,611		probably null	Het
Slc6a1	T	C	6: 114,311,854	M274T	possibly damaging	Het
Slco1a5	A	G	6: 142,242,063	S517P	probably benign	Het
Smo	A	G	6: 29,736,056	R16G	unknown	Het
Srebf1	A	G	11: 60,203,486	L601P	probably damaging	Het
Sspo	A	G	6: 48,459,350	I1086M	probably benign	Het
Tas2r106	A	T	6: 131,678,410	N159K	probably damaging	Het
Thsd1	G	A	8: 22,252,318		probably benign	Het
Tmeff1	T	C	4: 48,658,938		probably benign	Het
Tmem140	G	A	6: 34,872,903	C118Y	possibly damaging	Het
Tmem168	A	G	6: 13,583,071	C220R	probably benign	Het
Tox2	A	T	2: 163,276,167	N129Y	probably damaging	Het
Trappc12	C	T	12: 28,746,985	E183K	probably damaging	Het
Unc50	A	G	1: 37,438,799	Y254C	probably damaging	Het
Unk	T	G	11: 116,059,081	D691E	probably benign	Het
Uox	T	A	3: 146,610,379	V23D	probably damaging	Het
Vps13d	A	G	4: 145,126,606	C2313R	probably benign	Het
Zfp804b	T	A	5: 6,769,283	H1260L	probably damaging	Het
Zfyve26	A	G	12: 79,264,351	L147P	probably damaging	Het
Zmynd10	A	T	9: 107,550,037	Q288L	probably benign	Het
Zzef1	T	A	11: 72,848,714	D662E	probably damaging	Het

Other mutations in Dysf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Dysf	APN	6	84108099	missense	probably damaging	1.00
IGL00340:Dysf	APN	6	84141951	missense	probably benign	0.02
IGL00429:Dysf	APN	6	84189844	missense	probably damaging	1.00
IGL00465:Dysf	APN	6	84199848	critical splice donor site	probably null
IGL00800:Dysf	APN	6	84149998	missense	probably damaging	1.00
IGL01069:Dysf	APN	6	84199785	missense	possibly damaging	0.94
IGL01094:Dysf	APN	6	84194386	missense	probably damaging	1.00
IGL01420:Dysf	APN	6	84149759	nonsense	probably null
IGL01649:Dysf	APN	6	84199839	missense	probably damaging	1.00
IGL01923:Dysf	APN	6	84210829	makesense	probably null
IGL01991:Dysf	APN	6	84113618	missense	probably damaging	1.00
IGL01999:Dysf	APN	6	84113618	missense	probably damaging	1.00
IGL02002:Dysf	APN	6	84210787	splice site	probably benign
IGL02136:Dysf	APN	6	84108167	missense	probably benign	0.43
IGL02318:Dysf	APN	6	84186464	missense	possibly damaging	0.50
IGL02378:Dysf	APN	6	84111905	missense	probably damaging	1.00
IGL02404:Dysf	APN	6	84116061	missense	probably damaging	1.00
IGL02416:Dysf	APN	6	84192914	missense	possibly damaging	0.92
IGL02535:Dysf	APN	6	84149697	missense	possibly damaging	0.45
IGL02553:Dysf	APN	6	84130127	missense	possibly damaging	0.95
IGL02559:Dysf	APN	6	84067446	splice site	probably benign
IGL02563:Dysf	APN	6	84186516	splice site	probably benign
IGL02647:Dysf	APN	6	84137373	missense	probably damaging	1.00
IGL02820:Dysf	APN	6	84100205	missense	probably damaging	0.99
IGL02858:Dysf	APN	6	84099489	missense	probably benign	0.01
IGL02860:Dysf	APN	6	84190898	critical splice donor site	probably null
IGL02861:Dysf	APN	6	84039537	missense	probably damaging	0.99
IGL03008:Dysf	APN	6	84073894	missense	probably benign	0.01
IGL03023:Dysf	APN	6	84193007	missense	probably damaging	1.00
IGL03074:Dysf	APN	6	84188226	missense	probably benign	0.25
IGL03342:Dysf	APN	6	84190872	missense	probably benign
PIT4305001:Dysf	UTSW	6	84100234	nonsense	probably null
R0067:Dysf	UTSW	6	84063331	missense	possibly damaging	0.58
R0106:Dysf	UTSW	6	84113336	missense	probably benign	0.07
R0106:Dysf	UTSW	6	84113336	missense	probably benign	0.07
R0124:Dysf	UTSW	6	84065102	splice site	probably benign
R0219:Dysf	UTSW	6	84129461	splice site	probably benign
R0238:Dysf	UTSW	6	84064479	nonsense	probably null
R0238:Dysf	UTSW	6	84064479	nonsense	probably null
R0239:Dysf	UTSW	6	84064479	nonsense	probably null
R0239:Dysf	UTSW	6	84064479	nonsense	probably null
R0426:Dysf	UTSW	6	84149757	missense	probably damaging	1.00
R0455:Dysf	UTSW	6	84140667	missense	probably benign	0.29
R0482:Dysf	UTSW	6	84152405	missense	probably benign	0.03
R0545:Dysf	UTSW	6	84099461	missense	probably damaging	0.99
R0625:Dysf	UTSW	6	84111987	splice site	probably null
R0676:Dysf	UTSW	6	84113336	missense	probably benign	0.07
R0699:Dysf	UTSW	6	84190846	missense	probably benign	0.00
R1165:Dysf	UTSW	6	84067069	missense	probably damaging	0.98
R1455:Dysf	UTSW	6	84113386	missense	probably benign	0.01
R1582:Dysf	UTSW	6	84097767	missense	probably damaging	1.00
R1584:Dysf	UTSW	6	84067047	missense	probably benign	0.04
R1605:Dysf	UTSW	6	84106941	missense	probably damaging	0.96
R1674:Dysf	UTSW	6	84179715	missense	probably benign	0.01
R1739:Dysf	UTSW	6	84112235	critical splice donor site	probably null
R1765:Dysf	UTSW	6	84190902	splice site	probably null
R1813:Dysf	UTSW	6	84151924	missense	possibly damaging	0.83
R1960:Dysf	UTSW	6	84073903	missense	probably benign	0.12
R2216:Dysf	UTSW	6	84207245	splice site	probably null
R2242:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2243:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2245:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2246:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2280:Dysf	UTSW	6	84064494	missense	probably damaging	0.99
R2374:Dysf	UTSW	6	84097729	missense	probably damaging	1.00
R2403:Dysf	UTSW	6	84039567	missense	possibly damaging	0.84
R2763:Dysf	UTSW	6	84106932	missense	probably benign	0.00
R2895:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2916:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R2918:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3402:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3403:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3434:Dysf	UTSW	6	84070888	missense	probably benign	0.00
R3772:Dysf	UTSW	6	84152351	missense	possibly damaging	0.63
R3781:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3789:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3822:Dysf	UTSW	6	84207088	splice site	probably benign
R3918:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3919:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3939:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R3942:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R4177:Dysf	UTSW	6	84067031	nonsense	probably null
R4179:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R4180:Dysf	UTSW	6	84186509	critical splice donor site	probably null
R4299:Dysf	UTSW	6	84068077	missense	possibly damaging	0.78
R4419:Dysf	UTSW	6	84207242	critical splice donor site	probably null
R4446:Dysf	UTSW	6	84205872	missense	probably damaging	1.00
R4577:Dysf	UTSW	6	84137326	missense	probably damaging	1.00
R4680:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4708:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4709:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4710:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4725:Dysf	UTSW	6	84097756	missense	probably damaging	1.00
R4742:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4743:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4749:Dysf	UTSW	6	84067008	missense	probably damaging	1.00
R4787:Dysf	UTSW	6	84203328	nonsense	probably null
R4850:Dysf	UTSW	6	84097715	missense	probably damaging	0.99
R4868:Dysf	UTSW	6	84179693	missense	probably damaging	1.00
R4871:Dysf	UTSW	6	84067023	missense	possibly damaging	0.93
R4951:Dysf	UTSW	6	84114120	critical splice donor site	probably null
R4952:Dysf	UTSW	6	84149986	missense	possibly damaging	0.79
R5009:Dysf	UTSW	6	84151986	missense	probably damaging	1.00
R5072:Dysf	UTSW	6	84137272	missense	probably damaging	1.00
R5073:Dysf	UTSW	6	84137272	missense	probably damaging	1.00
R5074:Dysf	UTSW	6	84137272	missense	probably damaging	1.00
R5252:Dysf	UTSW	6	84186468	missense	probably damaging	0.98
R5260:Dysf	UTSW	6	84150034	missense	probably damaging	1.00
R5447:Dysf	UTSW	6	84195263	missense	probably damaging	0.98
R5501:Dysf	UTSW	6	84087818	missense	probably damaging	0.99
R5533:Dysf	UTSW	6	84186471	missense	probably damaging	0.99
R5611:Dysf	UTSW	6	84064878	missense	probably damaging	0.98
R5618:Dysf	UTSW	6	84106824	missense	probably benign	0.03
R5884:Dysf	UTSW	6	84186081	missense	probably damaging	1.00
R5927:Dysf	UTSW	6	84207212	missense	probably damaging	1.00
R6045:Dysf	UTSW	6	84114072	missense	probably damaging	0.99
R6056:Dysf	UTSW	6	84106862	missense	probably benign
R6084:Dysf	UTSW	6	84019604	missense	probably damaging	0.98
R6084:Dysf	UTSW	6	84112119	missense	probably damaging	1.00
R6146:Dysf	UTSW	6	84203199	missense	probably damaging	0.96
R6220:Dysf	UTSW	6	84149745	missense	probably damaging	0.97
R6232:Dysf	UTSW	6	84098253	missense	probably benign	0.26
R6247:Dysf	UTSW	6	84066999	missense	probably damaging	1.00
R6298:Dysf	UTSW	6	84107136	splice site	probably null
R6306:Dysf	UTSW	6	84137266	missense	possibly damaging	0.91
R6377:Dysf	UTSW	6	84008963	missense	probably benign
R6415:Dysf	UTSW	6	84140042	missense	probably damaging	1.00
R6444:Dysf	UTSW	6	84190840	missense	probably benign	0.36
R6470:Dysf	UTSW	6	84066944	missense	possibly damaging	0.93
R6504:Dysf	UTSW	6	84008925	missense	probably benign	0.03
R6557:Dysf	UTSW	6	84186384	missense	probably damaging	0.99
R6665:Dysf	UTSW	6	84130116	missense	probably benign
R6701:Dysf	UTSW	6	84112190	missense	probably damaging	1.00
R6776:Dysf	UTSW	6	84064894	missense	possibly damaging	0.88
R6909:Dysf	UTSW	6	84192938	missense	probably damaging	1.00
R7007:Dysf	UTSW	6	84113980	missense	probably damaging	1.00
R7013:Dysf	UTSW	6	84137358	missense	probably damaging	1.00
R7035:Dysf	UTSW	6	84186392	missense	probably benign	0.02
R7094:Dysf	UTSW	6	84100202	missense	probably benign	0.43
R7124:Dysf	UTSW	6	84190901	splice site	probably null
R7156:Dysf	UTSW	6	84087876	critical splice donor site	probably null
R7261:Dysf	UTSW	6	84193010	missense	probably damaging	0.98
R7296:Dysf	UTSW	6	84106898	missense	probably benign	0.33
R7356:Dysf	UTSW	6	84067461	missense	probably damaging	1.00
R7359:Dysf	UTSW	6	84195324	splice site	probably null
R7384:Dysf	UTSW	6	84114105	missense	probably benign	0.17
R7409:Dysf	UTSW	6	84149682	missense	probably benign	0.00
R7449:Dysf	UTSW	6	84137380	missense	possibly damaging	0.90
R7476:Dysf	UTSW	6	84064896	missense	probably benign	0.08
R7496:Dysf	UTSW	6	84067478	missense	probably benign	0.43
R7573:Dysf	UTSW	6	84130122	missense	possibly damaging	0.59
R7616:Dysf	UTSW	6	84101963	missense	probably benign	0.01
R7684:Dysf	UTSW	6	84100135	missense	probably benign	0.00
R7808:Dysf	UTSW	6	84070929	missense	possibly damaging	0.86
R7836:Dysf	UTSW	6	84137398	missense	probably damaging	1.00
R7868:Dysf	UTSW	6	84114099	missense	probably benign	0.00
R7873:Dysf	UTSW	6	84083765	missense	probably benign
R7956:Dysf	UTSW	6	84008996	missense	probably benign	0.01
R8130:Dysf	UTSW	6	84137376	missense	probably damaging	0.97
R8357:Dysf	UTSW	6	84188245	missense	probably benign	0.01
R8383:Dysf	UTSW	6	84019583	missense	probably damaging	1.00
R8457:Dysf	UTSW	6	84188245	missense	probably benign	0.01
R8693:Dysf	UTSW	6	84111970	missense	probably damaging	1.00
R8738:Dysf	UTSW	6	84194371	missense	probably damaging	1.00
R8808:Dysf	UTSW	6	84019484	start gained	probably benign
R8836:Dysf	UTSW	6	84116123	missense	probably damaging	1.00
R8915:Dysf	UTSW	6	84179754	missense	probably benign
R8959:Dysf	UTSW	6	84101963	missense	probably benign	0.01
R9091:Dysf	UTSW	6	84100234	nonsense	probably null
R9095:Dysf	UTSW	6	84179684	missense	probably benign	0.01
R9162:Dysf	UTSW	6	84112233	missense	probably damaging	1.00
R9164:Dysf	UTSW	6	84203326	missense	probably damaging	1.00
R9166:Dysf	UTSW	6	84149977	missense	probably damaging	1.00
R9173:Dysf	UTSW	6	84194397	missense	probably benign	0.10
R9191:Dysf	UTSW	6	84068066	missense	probably benign	0.43
R9270:Dysf	UTSW	6	84100234	nonsense	probably null
R9328:Dysf	UTSW	6	84073913	missense	probably damaging	1.00
R9470:Dysf	UTSW	6	84113370	missense	possibly damaging	0.59
R9509:Dysf	UTSW	6	84210797	missense	probably damaging	0.98
R9511:Dysf	UTSW	6	84113668	missense	probably damaging	1.00
R9526:Dysf	UTSW	6	84151903	missense	probably damaging	0.99
R9751:Dysf	UTSW	6	84186468	missense	probably damaging	0.98
X0063:Dysf	UTSW	6	84063354	missense	probably damaging	0.97
X0066:Dysf	UTSW	6	84114102	missense	possibly damaging	0.77
Z1176:Dysf	UTSW	6	84072685	missense	probably damaging	1.00
Z1177:Dysf	UTSW	6	84064523	missense	probably benign
Z1177:Dysf	UTSW	6	84087817	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- CCATCCATCCATTTATCCACCAG -3'
(R):5'- GATCCTAGCACACTGCCCC -3'

Sequencing Primer
(F):5'- GTCCACCTACCAAGCTACATG -3'
(R):5'- AGCTCTCAGTAAGATTTTCTCCCAG -3'

Posted On

2014-07-14