Incidental Mutation 'R1900:Ltf'
ID214210
Institutional Source Beutler Lab
Gene Symbol Ltf
Ensembl Gene ENSMUSG00000032496
Gene Namelactotransferrin
SynonymsLf, lactoferrin
MMRRC Submission 039920-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1900 (G1)
Quality Score216
Status Validated
Chromosome9
Chromosomal Location111019271-111042767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111022845 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 117 (F117L)
Ref Sequence ENSEMBL: ENSMUSP00000143234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035077] [ENSMUST00000196122] [ENSMUST00000196209] [ENSMUST00000196777] [ENSMUST00000198884]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035077
AA Change: F170L

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035077
Gene: ENSMUSG00000032496
AA Change: F170L

DomainStartEndE-ValueType
TR_FER 24 362 1.48e-209 SMART
TR_FER 363 696 4.68e-212 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000196122
AA Change: F117L

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143234
Gene: ENSMUSG00000032496
AA Change: F117L

DomainStartEndE-ValueType
TR_FER 4 183 6.4e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196209
SMART Domains Protein: ENSMUSP00000143731
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
Pfam:Transferrin 13 78 3.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196777
SMART Domains Protein: ENSMUSP00000143629
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
TR_FER 1 121 2.3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197893
Predicted Effect probably benign
Transcript: ENSMUST00000198152
Predicted Effect probably benign
Transcript: ENSMUST00000198884
SMART Domains Protein: ENSMUSP00000142432
Gene: ENSMUSG00000032496

DomainStartEndE-ValueType
TR_FER 1 95 4.3e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200459
Meta Mutation Damage Score 0.5977 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transferrin family of genes and its protein product is found in the secondary granules of neutrophils. The protein is a major iron-binding protein in milk and body secretions with an antimicrobial activity, making it an important component of the non-specific immune system. The protein demonstrates a broad spectrum of properties, including regulation of iron homeostasis, host defense against a broad range of microbial infections, anti-inflammatory activity, regulation of cellular growth and differentiation and protection against cancer development and metastasis. Antimicrobial, antiviral, antifungal and antiparasitic activity has been found for this protein and its peptides. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and grossly normal and exhibit only minor alterations in iron homeostasis. Mice homozygous for a different knock-out allele show increased susceptibility to inflammation-induced colorectal dysplasia along with increased cell proliferation and decreased apoptosis in colonic tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,770,583 T478A probably damaging Het
6330409D20Rik T C 2: 32,740,547 probably benign Het
Ago4 T C 4: 126,516,936 I221V probably benign Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Ankrd50 T C 3: 38,455,387 T944A probably damaging Het
AU040320 A C 4: 126,853,280 probably null Het
Axdnd1 A G 1: 156,380,774 probably null Het
Cdadc1 A T 14: 59,586,532 D170E probably damaging Het
Cep164 C A 9: 45,809,825 R93L probably damaging Het
Cep250 T C 2: 155,985,374 probably null Het
Cfdp1 G A 8: 111,768,729 R286* probably null Het
Chrdl2 A G 7: 100,033,664 I377V possibly damaging Het
Cntrob A T 11: 69,308,054 S623T probably benign Het
Col6a5 C T 9: 105,931,213 G879S unknown Het
Cyp2c38 T A 19: 39,438,312 I182F probably benign Het
Dennd4a T C 9: 64,897,336 V1319A probably damaging Het
Dysf T G 6: 84,039,567 V70G probably damaging Het
Edn3 A G 2: 174,761,605 T49A possibly damaging Het
Elac1 C G 18: 73,739,245 L226F probably damaging Het
Eps8l3 A G 3: 107,890,952 D445G probably benign Het
Fam71a T A 1: 191,164,434 K4M possibly damaging Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Fstl5 T A 3: 76,708,160 W843R probably damaging Het
Fyb2 A G 4: 104,945,455 R185G probably benign Het
Gal3st2c G A 1: 94,009,044 R237H probably damaging Het
Galnt15 G T 14: 32,049,865 R289L probably damaging Het
Gdf5 T A 2: 155,942,081 D317V probably damaging Het
Gm10436 A C 12: 88,177,260 L261R probably benign Het
Gm7808 A G 9: 19,928,114 probably benign Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Hdlbp A T 1: 93,422,237 probably benign Het
Hhip T C 8: 79,975,046 T620A probably benign Het
Hs3st3a1 T C 11: 64,520,442 S269P probably damaging Het
Il17ra A T 6: 120,477,394 probably null Het
Kif2a T C 13: 106,976,995 N417S possibly damaging Het
Klhl41 T A 2: 69,674,619 probably benign Het
L3mbtl4 G T 17: 68,459,805 C169F probably damaging Het
Lap3 T C 5: 45,511,910 F467S probably damaging Het
Lpar6 A T 14: 73,239,139 Y180F probably benign Het
Lrig3 T C 10: 126,002,393 probably benign Het
Ltbp2 A T 12: 84,830,658 S378T probably damaging Het
Med16 T C 10: 79,898,931 E533G probably damaging Het
Meltf T C 16: 31,881,969 probably null Het
Mphosph10 C T 7: 64,381,028 E488K possibly damaging Het
Mroh1 A G 15: 76,433,385 T812A probably benign Het
Mto1 T C 9: 78,461,517 probably benign Het
Ndst1 A T 18: 60,712,721 probably null Het
Ndst4 T A 3: 125,697,895 probably null Het
Nhlh1 A T 1: 172,054,041 I86N probably damaging Het
Nme9 A C 9: 99,459,774 D59A probably damaging Het
Nox4 A T 7: 87,360,796 R402* probably null Het
Npr1 T C 3: 90,462,188 D410G probably damaging Het
Nrip1 T A 16: 76,292,039 T877S probably benign Het
Nsd2 A G 5: 33,846,169 N221S probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1463 T A 19: 13,234,913 I221K possibly damaging Het
Olfr23 C A 11: 73,940,660 P138Q possibly damaging Het
Olfr250 A T 9: 38,368,064 I173L probably benign Het
Olfr561 A T 7: 102,775,331 H269L probably benign Het
Olfr61 A T 7: 140,638,592 D297V probably damaging Het
Olfr616 A T 7: 103,564,607 L224* probably null Het
Ophn1 A T X: 98,726,059 Y181* probably null Het
Parp1 A G 1: 180,597,339 K819R probably damaging Het
Parp9 T C 16: 35,972,221 S829P probably benign Het
Pde6c T A 19: 38,161,940 F511Y probably damaging Het
Per3 G T 4: 151,041,426 H145Q probably damaging Het
Pglyrp1 C T 7: 18,890,226 R145W probably damaging Het
Piezo1 T C 8: 122,482,645 probably benign Het
Plb1 T C 5: 32,286,847 I312T probably benign Het
Plin3 T A 17: 56,279,824 T408S possibly damaging Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prpmp5 A T 6: 132,314,698 L11Q unknown Het
Ptpn6 A G 6: 124,728,933 S83P probably benign Het
Rtp1 G T 16: 23,429,299 V41L probably benign Het
Scn4a A G 11: 106,327,533 I1035T probably damaging Het
Sell A T 1: 164,065,338 Y41F probably damaging Het
Serping1 C T 2: 84,771,449 V226M probably damaging Het
Sf3b1 A T 1: 54,998,188 D856E possibly damaging Het
Sfmbt1 T A 14: 30,802,567 Y503N probably damaging Het
Slc16a1 T A 3: 104,653,564 V395D probably damaging Het
Slc22a7 A T 17: 46,438,231 D53E probably benign Het
Slc35b3 A G 13: 38,960,611 probably null Het
Slc6a1 T C 6: 114,311,854 M274T possibly damaging Het
Slco1a5 A G 6: 142,242,063 S517P probably benign Het
Smo A G 6: 29,736,056 R16G unknown Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Sspo A G 6: 48,459,350 I1086M probably benign Het
Tas2r106 A T 6: 131,678,410 N159K probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tmeff1 T C 4: 48,658,938 probably benign Het
Tmem140 G A 6: 34,872,903 C118Y possibly damaging Het
Tmem168 A G 6: 13,583,071 C220R probably benign Het
Tox2 A T 2: 163,276,167 N129Y probably damaging Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unk T G 11: 116,059,081 D691E probably benign Het
Uox T A 3: 146,610,379 V23D probably damaging Het
Vps13d A G 4: 145,126,606 C2313R probably benign Het
Zfp804b T A 5: 6,769,283 H1260L probably damaging Het
Zfyve26 A G 12: 79,264,351 L147P probably damaging Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Zzef1 T A 11: 72,848,714 D662E probably damaging Het
Other mutations in Ltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ltf APN 9 111022882 splice site probably null
IGL01068:Ltf APN 9 111035812 splice site probably null
IGL01311:Ltf APN 9 111031012 unclassified probably benign
IGL01629:Ltf APN 9 111035806 missense probably damaging 1.00
IGL01765:Ltf APN 9 111022017 missense possibly damaging 0.86
IGL02376:Ltf APN 9 111029624 missense probably benign 0.01
IGL02429:Ltf APN 9 111026125 missense possibly damaging 0.87
IGL02947:Ltf APN 9 111038947 missense probably benign 0.01
IGL03025:Ltf APN 9 111025101 missense possibly damaging 0.93
R0041:Ltf UTSW 9 111029568 missense possibly damaging 0.92
R0364:Ltf UTSW 9 111025167 missense probably benign 0.19
R0718:Ltf UTSW 9 111040379 missense probably benign 0.01
R1899:Ltf UTSW 9 111022845 missense possibly damaging 0.84
R2964:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R2965:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R2966:Ltf UTSW 9 111028472 missense possibly damaging 0.81
R3051:Ltf UTSW 9 111024522 missense probably benign 0.00
R3122:Ltf UTSW 9 111022900 missense probably damaging 1.00
R4427:Ltf UTSW 9 111023604 missense probably damaging 1.00
R4597:Ltf UTSW 9 111022933 missense probably damaging 1.00
R4604:Ltf UTSW 9 111022341 missense probably damaging 0.99
R4827:Ltf UTSW 9 111027377 unclassified probably benign
R4849:Ltf UTSW 9 111025990 missense probably benign 0.00
R5389:Ltf UTSW 9 111029651 missense possibly damaging 0.50
R5677:Ltf UTSW 9 111020912 start codon destroyed probably null 0.01
R6419:Ltf UTSW 9 111031022 missense possibly damaging 0.67
R6891:Ltf UTSW 9 111025113 missense probably benign 0.13
R7032:Ltf UTSW 9 111026130 critical splice donor site probably null
R7090:Ltf UTSW 9 111025980 missense probably benign 0.00
R7352:Ltf UTSW 9 111028450 missense probably benign
R7656:Ltf UTSW 9 111024394 nonsense probably null
R7857:Ltf UTSW 9 111022376 missense probably benign 0.00
R8751:Ltf UTSW 9 111031124 nonsense probably null
R8802:Ltf UTSW 9 111020950 missense probably benign 0.00
Z1177:Ltf UTSW 9 111021005 missense probably benign 0.01
Z1177:Ltf UTSW 9 111024393 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCACGTCTGAGTTCCGAAG -3'
(R):5'- CGTCTGCACATCAGTAGGAC -3'

Sequencing Primer
(F):5'- TGAGTTCCGAAGCCCACTCAG -3'
(R):5'- TGAAGCTGTGCGACCATG -3'
Posted On2014-07-14