Incidental Mutation 'R1905:Pgap1'
ID214251
Institutional Source Beutler Lab
Gene Symbol Pgap1
Ensembl Gene ENSMUSG00000073678
Gene Namepost-GPI attachment to proteins 1
SynonymsPGAP1, D230012E17Rik, oto, 5033403E17Rik, 9030223K07Rik
MMRRC Submission 039924-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.771) question?
Stock #R1905 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location54472994-54557684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 54511961 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 520 (I520R)
Ref Sequence ENSEMBL: ENSMUSP00000095346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097739]
Predicted Effect probably benign
Transcript: ENSMUST00000097739
AA Change: I520R

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095346
Gene: ENSMUSG00000073678
AA Change: I520R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:PGAP1 82 302 7.2e-83 PFAM
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 678 700 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
transmembrane domain 819 838 N/A INTRINSIC
low complexity region 854 866 N/A INTRINSIC
low complexity region 871 884 N/A INTRINSIC
transmembrane domain 902 921 N/A INTRINSIC
Meta Mutation Damage Score 0.1243 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions early in the glycosylphosphatidylinositol (GPI) biosynthetic pathway, catalyzing the inositol deacylation of GPI. The encoded protein is required for the production of GPI that can attach to proteins, and this may be an important factor in the transport of GPI-anchored proteins from the endoplasmic reticulum to the Golgi. Defects in this gene are a cause of mental retardation, autosomal recessive 42. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mutations in this gene result in a variety of forebrain, eye, jaw, craniofacial, ear, and vertebra defects that are background sensitive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,469,680 V153L possibly damaging Het
Adamts17 T A 7: 67,047,472 C631* probably null Het
Adamts19 A G 18: 59,032,945 R1070G possibly damaging Het
Aldh1a1 A G 19: 20,617,998 E97G probably damaging Het
Bola2 T A 7: 126,696,238 V40E probably damaging Het
Ccar1 A G 10: 62,776,658 S243P possibly damaging Het
Cd80 A T 16: 38,474,177 I141F probably damaging Het
Chn2 T C 6: 54,286,121 C92R probably damaging Het
Clk1 A T 1: 58,421,942 probably benign Het
Clock T C 5: 76,266,888 probably benign Het
Cntnap3 A G 13: 64,903,764 V26A probably benign Het
Csf3r A T 4: 126,042,745 K651N probably benign Het
Cul4a T C 8: 13,133,171 M322T probably benign Het
Cx3cl1 A G 8: 94,780,059 T231A probably benign Het
Cyp2c68 A T 19: 39,735,582 C213S probably benign Het
Dhx16 T G 17: 35,888,355 S814A probably benign Het
Dnah1 T C 14: 31,264,630 I3659V probably benign Het
Dock6 A T 9: 21,829,574 V906D probably benign Het
Ep400 G A 5: 110,670,948 T2738I probably damaging Het
Erbb4 A T 1: 68,075,410 probably benign Het
Fam135b C T 15: 71,532,987 R70H probably damaging Het
Fam13a T C 6: 58,953,490 Q479R probably damaging Het
Fam96a A G 9: 66,132,647 K82R probably benign Het
Fcgr4 A T 1: 171,029,305 Q247L probably damaging Het
Flnc T A 6: 29,459,460 C2520S probably damaging Het
Foxn1 A G 11: 78,371,810 probably null Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fzd8 C T 18: 9,213,803 T295I probably damaging Het
Gm10499 T C 17: 36,142,941 noncoding transcript Het
Gm340 A G 19: 41,583,574 D256G possibly damaging Het
Gm4744 G A 6: 40,951,802 probably benign Het
Gm4871 G T 5: 145,030,049 A208D probably damaging Het
Gm5155 T A 7: 17,873,552 noncoding transcript Het
Gm527 A G 12: 64,921,023 N73S possibly damaging Het
Gm5414 T C 15: 101,624,640 I451V probably damaging Het
Golm1 A T 13: 59,642,251 V245E probably benign Het
Grik1 A T 16: 87,896,866 Y879* probably null Het
Grn C A 11: 102,436,450 P241Q probably damaging Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hmcn1 A C 1: 150,992,855 I66S probably damaging Het
Hykk T A 9: 54,946,383 Y330N probably benign Het
Khdc1c A G 1: 21,369,057 N89S probably benign Het
Lrrc72 T A 12: 36,208,662 probably null Het
Lyst T G 13: 13,634,134 S130A probably benign Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mfng T C 15: 78,773,086 T63A probably damaging Het
Mre11a G A 9: 14,799,627 D206N probably benign Het
Myh10 A G 11: 68,771,868 probably benign Het
Myt1 A G 2: 181,797,756 D357G probably damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncoa1 A G 12: 4,295,433 V638A probably damaging Het
Nlrp3 T G 11: 59,549,036 F480V probably damaging Het
Nos1ap A G 1: 170,318,558 W476R possibly damaging Het
Nr1h4 T A 10: 89,480,559 T220S possibly damaging Het
Ntf5 G T 7: 45,415,752 V103L probably damaging Het
Ntm C A 9: 29,179,097 D109Y probably damaging Het
Olfr18 C T 9: 20,314,846 E17K probably benign Het
P2rx7 G A 5: 122,680,952 C479Y probably damaging Het
Pappa2 T A 1: 158,803,503 probably null Het
Pikfyve G A 1: 65,192,295 probably null Het
Plekhg3 T C 12: 76,576,217 S744P probably benign Het
Pramel6 A G 2: 87,509,182 R97G probably damaging Het
Pramel6 G T 2: 87,509,183 R97M probably damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptk2b T C 14: 66,158,670 D783G probably damaging Het
Ptma-ps1 T A 7: 24,063,881 L17* probably null Het
Ralgapa2 C A 2: 146,387,701 R1053L probably damaging Het
Sap130 C T 18: 31,680,567 P559L possibly damaging Het
Sap30 T C 8: 57,487,311 S86G probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3f G T 9: 107,684,376 Q500K probably damaging Het
Serpinb3d T C 1: 107,079,284 I231M possibly damaging Het
Sf3a1 T A 11: 4,176,678 N563K probably benign Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc6a12 G T 6: 121,347,443 E9* probably null Het
Srebf1 T C 11: 60,204,493 D400G probably damaging Het
Swsap1 T C 9: 21,956,692 Y87H probably damaging Het
Tanc2 G A 11: 105,922,863 G1711D possibly damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tdrd9 T A 12: 112,063,627 probably benign Het
Tdrp T C 8: 13,954,079 D86G probably damaging Het
Tmem92 A T 11: 94,778,675 M106K probably benign Het
Tmf1 A T 6: 97,161,479 C764S possibly damaging Het
Ttc21a G T 9: 119,966,757 R1219L possibly damaging Het
Ttn C T 2: 76,763,448 G18870D probably damaging Het
Tubgcp6 T C 15: 89,100,608 Y1732C probably damaging Het
Vmn1r28 A G 6: 58,265,927 T252A probably benign Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Other mutations in Pgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Pgap1 APN 1 54492021 splice site probably benign
IGL01111:Pgap1 APN 1 54530943 missense probably benign 0.17
IGL01406:Pgap1 APN 1 54533414 splice site probably null
IGL01592:Pgap1 APN 1 54521311 missense probably damaging 1.00
IGL02005:Pgap1 APN 1 54551055 missense probably damaging 0.99
IGL02026:Pgap1 APN 1 54494819 missense probably benign 0.05
IGL02086:Pgap1 APN 1 54547988 missense probably damaging 1.00
IGL02354:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02361:Pgap1 APN 1 54512816 missense probably benign 0.02
IGL02995:Pgap1 APN 1 54493350 missense probably benign 0.19
IGL03012:Pgap1 APN 1 54533413 splice site probably benign
R0044:Pgap1 UTSW 1 54493368 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0109:Pgap1 UTSW 1 54494825 missense probably damaging 1.00
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0241:Pgap1 UTSW 1 54535951 splice site probably null
R0352:Pgap1 UTSW 1 54486458 splice site probably benign
R1297:Pgap1 UTSW 1 54528523 missense possibly damaging 0.94
R1429:Pgap1 UTSW 1 54494861 missense probably benign 0.01
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1465:Pgap1 UTSW 1 54528555 missense probably benign 0.11
R1542:Pgap1 UTSW 1 54492090 missense probably benign 0.16
R1816:Pgap1 UTSW 1 54492057 missense probably damaging 0.99
R1817:Pgap1 UTSW 1 54535969 missense probably benign 0.15
R2006:Pgap1 UTSW 1 54551061 missense possibly damaging 0.76
R3551:Pgap1 UTSW 1 54530143 missense possibly damaging 0.89
R3833:Pgap1 UTSW 1 54557465 missense probably damaging 0.99
R3901:Pgap1 UTSW 1 54493348 missense probably benign
R4487:Pgap1 UTSW 1 54528592 missense probably benign 0.26
R4874:Pgap1 UTSW 1 54530137 missense probably damaging 0.96
R5184:Pgap1 UTSW 1 54481856 missense probably damaging 1.00
R6181:Pgap1 UTSW 1 54512777 missense probably benign 0.05
R6212:Pgap1 UTSW 1 54514893 missense probably damaging 0.99
R6269:Pgap1 UTSW 1 54548008 nonsense probably null
R6525:Pgap1 UTSW 1 54481889 missense probably benign 0.00
R6944:Pgap1 UTSW 1 54530161 missense probably damaging 1.00
R7214:Pgap1 UTSW 1 54543061 missense possibly damaging 0.47
R7256:Pgap1 UTSW 1 54493207 critical splice donor site probably null
R7290:Pgap1 UTSW 1 54548066 missense possibly damaging 0.45
R7356:Pgap1 UTSW 1 54530134 missense probably benign 0.10
R7525:Pgap1 UTSW 1 54530922 missense probably benign 0.26
R7602:Pgap1 UTSW 1 54543186 missense probably damaging 1.00
X0025:Pgap1 UTSW 1 54481870 missense probably benign 0.26
X0060:Pgap1 UTSW 1 54536034 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATACCACAGCTACCTGGC -3'
(R):5'- ACCTTAATGTCTTTTGGGAGCATAG -3'

Sequencing Primer
(F):5'- GGAAGACGGTCATTTTTCAAATAGG -3'
(R):5'- TGGGAGCATAGTACTCGCTAATC -3'
Posted On2014-07-14