Incidental Mutation 'R1905:Pikfyve'
ID 214252
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms Pip5k3
MMRRC Submission 039924-MU
Accession Numbers

Genbank: NM_011086

Essential gene? Essential (E-score: 1.000) question?
Stock # R1905 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 65186683-65278695 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 65192295 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000185263] [ENSMUST00000190058]
AlphaFold Q9Z1T6
Predicted Effect probably null
Transcript: ENSMUST00000081154
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081154
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably null
Transcript: ENSMUST00000097707
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189925
Predicted Effect probably benign
Transcript: ENSMUST00000190058
SMART Domains Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213081
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,469,680 V153L possibly damaging Het
Adamts17 T A 7: 67,047,472 C631* probably null Het
Adamts19 A G 18: 59,032,945 R1070G possibly damaging Het
Aldh1a1 A G 19: 20,617,998 E97G probably damaging Het
Bola2 T A 7: 126,696,238 V40E probably damaging Het
Ccar1 A G 10: 62,776,658 S243P possibly damaging Het
Cd80 A T 16: 38,474,177 I141F probably damaging Het
Chn2 T C 6: 54,286,121 C92R probably damaging Het
Clk1 A T 1: 58,421,942 probably benign Het
Clock T C 5: 76,266,888 probably benign Het
Cntnap3 A G 13: 64,903,764 V26A probably benign Het
Csf3r A T 4: 126,042,745 K651N probably benign Het
Cul4a T C 8: 13,133,171 M322T probably benign Het
Cx3cl1 A G 8: 94,780,059 T231A probably benign Het
Cyp2c68 A T 19: 39,735,582 C213S probably benign Het
Dhx16 T G 17: 35,888,355 S814A probably benign Het
Dnah1 T C 14: 31,264,630 I3659V probably benign Het
Dock6 A T 9: 21,829,574 V906D probably benign Het
Ep400 G A 5: 110,670,948 T2738I probably damaging Het
Erbb4 A T 1: 68,075,410 probably benign Het
Fam135b C T 15: 71,532,987 R70H probably damaging Het
Fam13a T C 6: 58,953,490 Q479R probably damaging Het
Fam96a A G 9: 66,132,647 K82R probably benign Het
Fcgr4 A T 1: 171,029,305 Q247L probably damaging Het
Flnc T A 6: 29,459,460 C2520S probably damaging Het
Foxn1 A G 11: 78,371,810 probably null Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fzd8 C T 18: 9,213,803 T295I probably damaging Het
Gm10499 T C 17: 36,142,941 noncoding transcript Het
Gm340 A G 19: 41,583,574 D256G possibly damaging Het
Gm4744 G A 6: 40,951,802 probably benign Het
Gm4871 G T 5: 145,030,049 A208D probably damaging Het
Gm5155 T A 7: 17,873,552 noncoding transcript Het
Gm527 A G 12: 64,921,023 N73S possibly damaging Het
Gm5414 T C 15: 101,624,640 I451V probably damaging Het
Golm1 A T 13: 59,642,251 V245E probably benign Het
Grik1 A T 16: 87,896,866 Y879* probably null Het
Grn C A 11: 102,436,450 P241Q probably damaging Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hmcn1 A C 1: 150,992,855 I66S probably damaging Het
Hykk T A 9: 54,946,383 Y330N probably benign Het
Khdc1c A G 1: 21,369,057 N89S probably benign Het
Lrrc72 T A 12: 36,208,662 probably null Het
Lyst T G 13: 13,634,134 S130A probably benign Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mfng T C 15: 78,773,086 T63A probably damaging Het
Mre11a G A 9: 14,799,627 D206N probably benign Het
Myh10 A G 11: 68,771,868 probably benign Het
Myt1 A G 2: 181,797,756 D357G probably damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncoa1 A G 12: 4,295,433 V638A probably damaging Het
Nlrp3 T G 11: 59,549,036 F480V probably damaging Het
Nos1ap A G 1: 170,318,558 W476R possibly damaging Het
Nr1h4 T A 10: 89,480,559 T220S possibly damaging Het
Ntf5 G T 7: 45,415,752 V103L probably damaging Het
Ntm C A 9: 29,179,097 D109Y probably damaging Het
Olfr18 C T 9: 20,314,846 E17K probably benign Het
P2rx7 G A 5: 122,680,952 C479Y probably damaging Het
Pappa2 T A 1: 158,803,503 probably null Het
Pgap1 A C 1: 54,511,961 I520R probably benign Het
Plekhg3 T C 12: 76,576,217 S744P probably benign Het
Pramel6 A G 2: 87,509,182 R97G probably damaging Het
Pramel6 G T 2: 87,509,183 R97M probably damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptk2b T C 14: 66,158,670 D783G probably damaging Het
Ptma-ps1 T A 7: 24,063,881 L17* probably null Het
Ralgapa2 C A 2: 146,387,701 R1053L probably damaging Het
Sap130 C T 18: 31,680,567 P559L possibly damaging Het
Sap30 T C 8: 57,487,311 S86G probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3f G T 9: 107,684,376 Q500K probably damaging Het
Serpinb3d T C 1: 107,079,284 I231M possibly damaging Het
Sf3a1 T A 11: 4,176,678 N563K probably benign Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc6a12 G T 6: 121,347,443 E9* probably null Het
Srebf1 T C 11: 60,204,493 D400G probably damaging Het
Swsap1 T C 9: 21,956,692 Y87H probably damaging Het
Tanc2 G A 11: 105,922,863 G1711D possibly damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tdrd9 T A 12: 112,063,627 probably benign Het
Tdrp T C 8: 13,954,079 D86G probably damaging Het
Tmem92 A T 11: 94,778,675 M106K probably benign Het
Tmf1 A T 6: 97,161,479 C764S possibly damaging Het
Ttc21a G T 9: 119,966,757 R1219L possibly damaging Het
Ttn C T 2: 76,763,448 G18870D probably damaging Het
Tubgcp6 T C 15: 89,100,608 Y1732C probably damaging Het
Vmn1r28 A G 6: 58,265,927 T252A probably benign Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65260121 critical splice donor site probably null
IGL01135:Pikfyve APN 1 65251635 missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65258869 nonsense probably null
IGL01759:Pikfyve APN 1 65253353 missense probably benign 0.06
IGL01888:Pikfyve APN 1 65223640 missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65264365 missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65238544 critical splice donor site probably null
IGL02119:Pikfyve APN 1 65272571 missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65246397 missense probably benign 0.13
IGL02207:Pikfyve APN 1 65251678 critical splice donor site probably null
IGL02380:Pikfyve APN 1 65256021 missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65252569 missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65244504 missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65251612 missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65264376 missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65230855 critical splice donor site probably null
IGL02746:Pikfyve APN 1 65234272 missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65250194 nonsense probably null
IGL02890:Pikfyve APN 1 65230797 missense probably benign 0.00
IGL03102:Pikfyve APN 1 65252467 nonsense probably null
IGL03294:Pikfyve APN 1 65247067 missense probably damaging 1.00
falcon UTSW 1 65196741 missense probably damaging 1.00
oompa UTSW 1 65196706 missense probably damaging 1.00
wonka UTSW 1 65196706 missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65202916 missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65215929 splice site probably benign
R0196:Pikfyve UTSW 1 65256072 missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65262905 missense probably benign 0.41
R0319:Pikfyve UTSW 1 65246331 missense probably benign 0.01
R0332:Pikfyve UTSW 1 65264399 missense probably benign 0.02
R0389:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65219899 missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65253523 missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65253397 missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65265824 missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65246959 missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65271311 missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65224201 missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65262977 critical splice donor site probably null
R1501:Pikfyve UTSW 1 65265284 missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65252548 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65192271 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65246370 missense probably benign
R1795:Pikfyve UTSW 1 65252557 missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65258798 missense probably benign 0.03
R1995:Pikfyve UTSW 1 65246708 missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65222357 missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65253353 missense probably benign 0.06
R2229:Pikfyve UTSW 1 65267855 missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65246676 missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65253517 missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65245758 missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65244420 missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65230845 missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65196681 missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65190520 unclassified probably benign
R4542:Pikfyve UTSW 1 65244430 missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65192192 missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65234262 missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65267846 missense probably benign
R4716:Pikfyve UTSW 1 65246476 missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65272515 missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65267846 missense probably benign
R4785:Pikfyve UTSW 1 65267846 missense probably benign
R4805:Pikfyve UTSW 1 65268800 missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65196741 missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65246590 missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65224117 intron probably benign
R5265:Pikfyve UTSW 1 65267829 missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65196699 nonsense probably null
R5384:Pikfyve UTSW 1 65244409 missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65265268 missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65235033 missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65252495 missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65273730 missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65256088 missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65216028 missense probably benign 0.09
R5891:Pikfyve UTSW 1 65202737 missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65253438 nonsense probably null
R6026:Pikfyve UTSW 1 65272697 missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65272571 missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65216043 missense probably benign 0.36
R6287:Pikfyve UTSW 1 65253532 critical splice donor site probably null
R6290:Pikfyve UTSW 1 65202925 critical splice donor site probably null
R6296:Pikfyve UTSW 1 65262953 missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65265781 missense probably benign 0.35
R6835:Pikfyve UTSW 1 65258843 missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65252530 missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65246663 missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65234361 missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65246854 missense probably benign 0.01
R7057:Pikfyve UTSW 1 65247205 missense probably benign 0.00
R7525:Pikfyve UTSW 1 65244426 nonsense probably null
R7558:Pikfyve UTSW 1 65272623 missense probably benign 0.01
R7625:Pikfyve UTSW 1 65267877 missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65269942 missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65265789 missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65246395 missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65253342 splice site probably benign
R8307:Pikfyve UTSW 1 65245735 missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65215996 missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65244417 missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65271268 missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65246970 missense probably benign 0.00
R8995:Pikfyve UTSW 1 65205587 critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65244400 missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65246080 missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65196739 missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65252560 missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65252560 missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65260029 missense probably benign 0.37
R9368:Pikfyve UTSW 1 65268742 missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65264402 missense probably benign
R9605:Pikfyve UTSW 1 65264402 missense probably benign
R9686:Pikfyve UTSW 1 65252456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATTTCCTTTGTCACAGAGCG -3'
(R):5'- TCTCTGCTGAAACCCAAGCAAG -3'

Sequencing Primer
(F):5'- TCCTTTGTCACAGAGCGAGGAG -3'
(R):5'- AATCAAGACATCAGTGCTTGC -3'
Posted On 2014-07-14