Incidental Mutation 'R1905:Erbb4'
ID 214253
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Name erb-b2 receptor tyrosine kinase 4
Synonyms Her4, ErbB4
MMRRC Submission 039924-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1905 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 68071345-69147218 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 68114569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473]
AlphaFold Q61527
Predicted Effect probably benign
Transcript: ENSMUST00000119142
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121473
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,606,216 (GRCm39) V153L possibly damaging Het
Adamts17 T A 7: 66,697,220 (GRCm39) C631* probably null Het
Adamts19 A G 18: 59,166,017 (GRCm39) R1070G possibly damaging Het
Aldh1a1 A G 19: 20,595,362 (GRCm39) E97G probably damaging Het
Bola2 T A 7: 126,295,410 (GRCm39) V40E probably damaging Het
Ccar1 A G 10: 62,612,437 (GRCm39) S243P possibly damaging Het
Cd80 A T 16: 38,294,539 (GRCm39) I141F probably damaging Het
Ceacam23 T A 7: 17,607,477 (GRCm39) noncoding transcript Het
Chn2 T C 6: 54,263,106 (GRCm39) C92R probably damaging Het
Ciao2a A G 9: 66,039,929 (GRCm39) K82R probably benign Het
Clk1 A T 1: 58,461,101 (GRCm39) probably benign Het
Clock T C 5: 76,414,735 (GRCm39) probably benign Het
Cntnap3 A G 13: 65,051,578 (GRCm39) V26A probably benign Het
Csf3r A T 4: 125,936,538 (GRCm39) K651N probably benign Het
Cul4a T C 8: 13,183,171 (GRCm39) M322T probably benign Het
Cx3cl1 A G 8: 95,506,687 (GRCm39) T231A probably benign Het
Cyp2c68 A T 19: 39,724,026 (GRCm39) C213S probably benign Het
Dhx16 T G 17: 36,199,247 (GRCm39) S814A probably benign Het
Dnah1 T C 14: 30,986,587 (GRCm39) I3659V probably benign Het
Dock6 A T 9: 21,740,870 (GRCm39) V906D probably benign Het
Ep400 G A 5: 110,818,814 (GRCm39) T2738I probably damaging Het
Fam135b C T 15: 71,404,836 (GRCm39) R70H probably damaging Het
Fam13a T C 6: 58,930,475 (GRCm39) Q479R probably damaging Het
Fcgr4 A T 1: 170,856,874 (GRCm39) Q247L probably damaging Het
Flnc T A 6: 29,459,459 (GRCm39) C2520S probably damaging Het
Foxn1 A G 11: 78,262,636 (GRCm39) probably null Het
Fsip2 C T 2: 82,813,772 (GRCm39) P3364S possibly damaging Het
Fzd8 C T 18: 9,213,803 (GRCm39) T295I probably damaging Het
Gm4744 G A 6: 40,928,736 (GRCm39) probably benign Het
Gm4871 G T 5: 144,966,859 (GRCm39) A208D probably damaging Het
Gm527 A G 12: 64,967,797 (GRCm39) N73S possibly damaging Het
Gm5414 T C 15: 101,533,075 (GRCm39) I451V probably damaging Het
Golm1 A T 13: 59,790,065 (GRCm39) V245E probably benign Het
Grik1 A T 16: 87,693,754 (GRCm39) Y879* probably null Het
Grn C A 11: 102,327,276 (GRCm39) P241Q probably damaging Het
H2-T7 T C 17: 36,453,833 (GRCm39) noncoding transcript Het
Hjurp T C 1: 88,194,338 (GRCm39) E190G probably benign Het
Hmcn1 A C 1: 150,868,606 (GRCm39) I66S probably damaging Het
Hykk T A 9: 54,853,667 (GRCm39) Y330N probably benign Het
Khdc1c A G 1: 21,439,281 (GRCm39) N89S probably benign Het
Lcor A G 19: 41,572,013 (GRCm39) D256G possibly damaging Het
Lrrc72 T A 12: 36,258,661 (GRCm39) probably null Het
Lyst T G 13: 13,808,719 (GRCm39) S130A probably benign Het
Mast1 G A 8: 85,642,895 (GRCm39) R967C probably damaging Het
Mfng T C 15: 78,657,286 (GRCm39) T63A probably damaging Het
Mre11a G A 9: 14,710,923 (GRCm39) D206N probably benign Het
Myh10 A G 11: 68,662,694 (GRCm39) probably benign Het
Myt1 A G 2: 181,439,549 (GRCm39) D357G probably damaging Het
Nacad T A 11: 6,552,540 (GRCm39) H217L probably benign Het
Ncoa1 A G 12: 4,345,433 (GRCm39) V638A probably damaging Het
Nlrp3 T G 11: 59,439,862 (GRCm39) F480V probably damaging Het
Nos1ap A G 1: 170,146,127 (GRCm39) W476R possibly damaging Het
Nr1h4 T A 10: 89,316,421 (GRCm39) T220S possibly damaging Het
Ntf5 G T 7: 45,065,176 (GRCm39) V103L probably damaging Het
Ntm C A 9: 29,090,393 (GRCm39) D109Y probably damaging Het
Or7e178 C T 9: 20,226,142 (GRCm39) E17K probably benign Het
P2rx7 G A 5: 122,819,015 (GRCm39) C479Y probably damaging Het
Pappa2 T A 1: 158,631,073 (GRCm39) probably null Het
Pgap1 A C 1: 54,551,120 (GRCm39) I520R probably benign Het
Pikfyve G A 1: 65,231,454 (GRCm39) probably null Het
Plekhg3 T C 12: 76,622,991 (GRCm39) S744P probably benign Het
Pramel6 A G 2: 87,339,526 (GRCm39) R97G probably damaging Het
Pramel6 G T 2: 87,339,527 (GRCm39) R97M probably damaging Het
Psme4 T C 11: 30,760,922 (GRCm39) V397A probably damaging Het
Ptk2b T C 14: 66,396,119 (GRCm39) D783G probably damaging Het
Ptma-ps1 T A 7: 23,763,306 (GRCm39) L17* probably null Het
Ralgapa2 C A 2: 146,229,621 (GRCm39) R1053L probably damaging Het
Sap130 C T 18: 31,813,620 (GRCm39) P559L possibly damaging Het
Sap30 T C 8: 57,940,345 (GRCm39) S86G probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sema3f G T 9: 107,561,575 (GRCm39) Q500K probably damaging Het
Serpinb3d T C 1: 107,007,014 (GRCm39) I231M possibly damaging Het
Sf3a1 T A 11: 4,126,678 (GRCm39) N563K probably benign Het
Sipa1l3 A G 7: 29,038,592 (GRCm39) S352P possibly damaging Het
Slc6a12 G T 6: 121,324,402 (GRCm39) E9* probably null Het
Srebf1 T C 11: 60,095,319 (GRCm39) D400G probably damaging Het
Swsap1 T C 9: 21,867,988 (GRCm39) Y87H probably damaging Het
Tanc2 G A 11: 105,813,689 (GRCm39) G1711D possibly damaging Het
Tas2r107 T C 6: 131,636,951 (GRCm39) M33V probably benign Het
Tdrd9 T A 12: 112,030,061 (GRCm39) probably benign Het
Tdrp T C 8: 14,004,079 (GRCm39) D86G probably damaging Het
Tmem92 A T 11: 94,669,501 (GRCm39) M106K probably benign Het
Tmf1 A T 6: 97,138,440 (GRCm39) C764S possibly damaging Het
Ttc21a G T 9: 119,795,823 (GRCm39) R1219L possibly damaging Het
Ttn C T 2: 76,593,792 (GRCm39) G18870D probably damaging Het
Tubgcp6 T C 15: 88,984,811 (GRCm39) Y1732C probably damaging Het
Vmn1r28 A G 6: 58,242,912 (GRCm39) T252A probably benign Het
Xirp2 A G 2: 67,346,700 (GRCm39) I2980M probably damaging Het
Zc2hc1c A G 12: 85,337,288 (GRCm39) D315G probably benign Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68,110,789 (GRCm39) nonsense probably null
IGL01020:Erbb4 APN 1 68,337,608 (GRCm39) splice site probably benign
IGL01349:Erbb4 APN 1 68,385,752 (GRCm39) missense probably benign 0.00
IGL01386:Erbb4 APN 1 68,383,090 (GRCm39) missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68,367,404 (GRCm39) nonsense probably null
IGL01536:Erbb4 APN 1 68,329,441 (GRCm39) missense probably benign 0.00
IGL01721:Erbb4 APN 1 68,293,722 (GRCm39) missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68,293,725 (GRCm39) missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68,119,885 (GRCm39) missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68,081,694 (GRCm39) missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68,329,453 (GRCm39) missense probably benign 0.00
IGL02399:Erbb4 APN 1 68,081,596 (GRCm39) splice site probably benign
IGL02553:Erbb4 APN 1 68,345,023 (GRCm39) missense probably benign 0.17
IGL03118:Erbb4 APN 1 68,081,878 (GRCm39) missense probably benign 0.11
IGL03329:Erbb4 APN 1 68,367,281 (GRCm39) missense probably benign 0.30
IGL03405:Erbb4 APN 1 68,369,397 (GRCm39) missense probably benign 0.02
earthworm UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
excrescence UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
Mole UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68,110,835 (GRCm39) missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68,114,702 (GRCm39) missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68,083,119 (GRCm39) intron probably benign
R0329:Erbb4 UTSW 1 68,337,439 (GRCm39) splice site probably benign
R0335:Erbb4 UTSW 1 68,298,418 (GRCm39) missense probably benign
R0362:Erbb4 UTSW 1 68,369,429 (GRCm39) missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68,081,621 (GRCm39) missense probably benign 0.17
R0730:Erbb4 UTSW 1 68,298,449 (GRCm39) missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68,348,773 (GRCm39) missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68,293,759 (GRCm39) missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68,599,841 (GRCm39) missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68,385,705 (GRCm39) missense probably benign 0.00
R1523:Erbb4 UTSW 1 68,435,411 (GRCm39) missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68,117,741 (GRCm39) nonsense probably null
R1604:Erbb4 UTSW 1 68,385,728 (GRCm39) missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68,079,547 (GRCm39) missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68,370,393 (GRCm39) missense probably damaging 1.00
R1929:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68,337,482 (GRCm39) missense probably benign 0.02
R2139:Erbb4 UTSW 1 68,385,788 (GRCm39) missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68,238,047 (GRCm39) missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68,081,690 (GRCm39) missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68,117,755 (GRCm39) missense probably benign 0.00
R3821:Erbb4 UTSW 1 68,345,072 (GRCm39) missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68,779,560 (GRCm39) missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68,079,496 (GRCm39) missense probably benign 0.07
R4196:Erbb4 UTSW 1 68,383,014 (GRCm39) missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68,385,781 (GRCm39) missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68,383,080 (GRCm39) nonsense probably null
R4642:Erbb4 UTSW 1 68,289,791 (GRCm39) missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68,383,059 (GRCm39) missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68,337,473 (GRCm39) missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68,369,405 (GRCm39) missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68,293,703 (GRCm39) missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68,369,397 (GRCm39) missense probably benign 0.02
R5068:Erbb4 UTSW 1 68,083,061 (GRCm39) splice site probably null
R5546:Erbb4 UTSW 1 68,337,452 (GRCm39) missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68,599,678 (GRCm39) missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68,083,075 (GRCm39) missense probably benign
R6257:Erbb4 UTSW 1 68,435,432 (GRCm39) missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68,599,735 (GRCm39) missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68,081,689 (GRCm39) missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68,409,662 (GRCm39) missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68,079,462 (GRCm39) missense probably benign 0.00
R7087:Erbb4 UTSW 1 68,779,650 (GRCm39) missense probably null 1.00
R7215:Erbb4 UTSW 1 68,378,619 (GRCm39) missense probably benign
R7356:Erbb4 UTSW 1 68,378,514 (GRCm39) critical splice donor site probably null
R7509:Erbb4 UTSW 1 68,289,739 (GRCm39) missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68,293,758 (GRCm39) missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68,367,278 (GRCm39) missense probably benign 0.00
R7784:Erbb4 UTSW 1 68,114,658 (GRCm39) missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68,081,885 (GRCm39) missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68,298,368 (GRCm39) missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68,435,470 (GRCm39) missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68,337,509 (GRCm39) missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68,110,789 (GRCm39) missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68,348,785 (GRCm39) missense probably benign
R8783:Erbb4 UTSW 1 68,079,331 (GRCm39) missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68,114,627 (GRCm39) missense probably damaging 1.00
R8881:Erbb4 UTSW 1 68,382,997 (GRCm39) critical splice donor site probably null
R9053:Erbb4 UTSW 1 68,289,779 (GRCm39) missense possibly damaging 0.63
R9142:Erbb4 UTSW 1 68,388,552 (GRCm39) missense probably damaging 1.00
R9237:Erbb4 UTSW 1 68,081,601 (GRCm39) missense possibly damaging 0.72
R9350:Erbb4 UTSW 1 68,329,638 (GRCm39) missense probably benign 0.00
R9374:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9434:Erbb4 UTSW 1 68,081,773 (GRCm39) missense possibly damaging 0.84
R9499:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9551:Erbb4 UTSW 1 68,779,642 (GRCm39) nonsense probably null
R9753:Erbb4 UTSW 1 68,238,062 (GRCm39) missense probably benign 0.00
X0019:Erbb4 UTSW 1 68,112,304 (GRCm39) missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68,367,418 (GRCm39) nonsense probably null
Z1176:Erbb4 UTSW 1 68,337,561 (GRCm39) frame shift probably null
Z1177:Erbb4 UTSW 1 68,348,802 (GRCm39) missense probably benign 0.06
Z1177:Erbb4 UTSW 1 68,329,635 (GRCm39) missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68,298,342 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTAACTTAGTGGCATACTATTACCTC -3'
(R):5'- GTGCATCGTGATACGTGTTCATTC -3'

Sequencing Primer
(F):5'- CAGAGAAACATTTTGCAGGTAA -3'
(R):5'- CGTGTTCATTCAAATTGTGACAG -3'
Posted On 2014-07-14