Mutagenetix > Incidental Mutation

Incidental Mutation 'R1905:Psme4'

214304

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

039924-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1905 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 30810922 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 397 (V397A)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably damaging
Transcript: ENSMUST00000041231
AA Change: V397A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: V397A

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133430

Meta Mutation Damage Score

0.8178

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 93.1%

Validation Efficiency

99% (90/91)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	G	T	13: 119,469,680	V153L	possibly damaging	Het
Adamts17	T	A	7: 67,047,472	C631*	probably null	Het
Adamts19	A	G	18: 59,032,945	R1070G	possibly damaging	Het
Aldh1a1	A	G	19: 20,617,998	E97G	probably damaging	Het
Bola2	T	A	7: 126,696,238	V40E	probably damaging	Het
Ccar1	A	G	10: 62,776,658	S243P	possibly damaging	Het
Cd80	A	T	16: 38,474,177	I141F	probably damaging	Het
Chn2	T	C	6: 54,286,121	C92R	probably damaging	Het
Clk1	A	T	1: 58,421,942		probably benign	Het
Clock	T	C	5: 76,266,888		probably benign	Het
Cntnap3	A	G	13: 64,903,764	V26A	probably benign	Het
Csf3r	A	T	4: 126,042,745	K651N	probably benign	Het
Cul4a	T	C	8: 13,133,171	M322T	probably benign	Het
Cx3cl1	A	G	8: 94,780,059	T231A	probably benign	Het
Cyp2c68	A	T	19: 39,735,582	C213S	probably benign	Het
Dhx16	T	G	17: 35,888,355	S814A	probably benign	Het
Dnah1	T	C	14: 31,264,630	I3659V	probably benign	Het
Dock6	A	T	9: 21,829,574	V906D	probably benign	Het
Ep400	G	A	5: 110,670,948	T2738I	probably damaging	Het
Erbb4	A	T	1: 68,075,410		probably benign	Het
Fam135b	C	T	15: 71,532,987	R70H	probably damaging	Het
Fam13a	T	C	6: 58,953,490	Q479R	probably damaging	Het
Fam96a	A	G	9: 66,132,647	K82R	probably benign	Het
Fcgr4	A	T	1: 171,029,305	Q247L	probably damaging	Het
Flnc	T	A	6: 29,459,460	C2520S	probably damaging	Het
Foxn1	A	G	11: 78,371,810		probably null	Het
Fsip2	C	T	2: 82,983,428	P3364S	possibly damaging	Het
Fzd8	C	T	18: 9,213,803	T295I	probably damaging	Het
Gm10499	T	C	17: 36,142,941		noncoding transcript	Het
Gm340	A	G	19: 41,583,574	D256G	possibly damaging	Het
Gm4744	G	A	6: 40,951,802		probably benign	Het
Gm4871	G	T	5: 145,030,049	A208D	probably damaging	Het
Gm5155	T	A	7: 17,873,552		noncoding transcript	Het
Gm527	A	G	12: 64,921,023	N73S	possibly damaging	Het
Gm5414	T	C	15: 101,624,640	I451V	probably damaging	Het
Golm1	A	T	13: 59,642,251	V245E	probably benign	Het
Grik1	A	T	16: 87,896,866	Y879*	probably null	Het
Grn	C	A	11: 102,436,450	P241Q	probably damaging	Het
Hjurp	T	C	1: 88,266,616	E190G	probably benign	Het
Hmcn1	A	C	1: 150,992,855	I66S	probably damaging	Het
Hykk	T	A	9: 54,946,383	Y330N	probably benign	Het
Khdc1c	A	G	1: 21,369,057	N89S	probably benign	Het
Lrrc72	T	A	12: 36,208,662		probably null	Het
Lyst	T	G	13: 13,634,134	S130A	probably benign	Het
Mast1	G	A	8: 84,916,266	R967C	probably damaging	Het
Mfng	T	C	15: 78,773,086	T63A	probably damaging	Het
Mre11a	G	A	9: 14,799,627	D206N	probably benign	Het
Myh10	A	G	11: 68,771,868		probably benign	Het
Myt1	A	G	2: 181,797,756	D357G	probably damaging	Het
Nacad	T	A	11: 6,602,540	H217L	probably benign	Het
Ncoa1	A	G	12: 4,295,433	V638A	probably damaging	Het
Nlrp3	T	G	11: 59,549,036	F480V	probably damaging	Het
Nos1ap	A	G	1: 170,318,558	W476R	possibly damaging	Het
Nr1h4	T	A	10: 89,480,559	T220S	possibly damaging	Het
Ntf5	G	T	7: 45,415,752	V103L	probably damaging	Het
Ntm	C	A	9: 29,179,097	D109Y	probably damaging	Het
Olfr18	C	T	9: 20,314,846	E17K	probably benign	Het
P2rx7	G	A	5: 122,680,952	C479Y	probably damaging	Het
Pappa2	T	A	1: 158,803,503		probably null	Het
Pgap1	A	C	1: 54,511,961	I520R	probably benign	Het
Pikfyve	G	A	1: 65,192,295		probably null	Het
Plekhg3	T	C	12: 76,576,217	S744P	probably benign	Het
Pramel6	A	G	2: 87,509,182	R97G	probably damaging	Het
Pramel6	G	T	2: 87,509,183	R97M	probably damaging	Het
Ptk2b	T	C	14: 66,158,670	D783G	probably damaging	Het
Ptma-ps1	T	A	7: 24,063,881	L17*	probably null	Het
Ralgapa2	C	A	2: 146,387,701	R1053L	probably damaging	Het
Sap130	C	T	18: 31,680,567	P559L	possibly damaging	Het
Sap30	T	C	8: 57,487,311	S86G	probably damaging	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sema3f	G	T	9: 107,684,376	Q500K	probably damaging	Het
Serpinb3d	T	C	1: 107,079,284	I231M	possibly damaging	Het
Sf3a1	T	A	11: 4,176,678	N563K	probably benign	Het
Sipa1l3	A	G	7: 29,339,167	S352P	possibly damaging	Het
Slc6a12	G	T	6: 121,347,443	E9*	probably null	Het
Srebf1	T	C	11: 60,204,493	D400G	probably damaging	Het
Swsap1	T	C	9: 21,956,692	Y87H	probably damaging	Het
Tanc2	G	A	11: 105,922,863	G1711D	possibly damaging	Het
Tas2r107	T	C	6: 131,659,988	M33V	probably benign	Het
Tdrd9	T	A	12: 112,063,627		probably benign	Het
Tdrp	T	C	8: 13,954,079	D86G	probably damaging	Het
Tmem92	A	T	11: 94,778,675	M106K	probably benign	Het
Tmf1	A	T	6: 97,161,479	C764S	possibly damaging	Het
Ttc21a	G	T	9: 119,966,757	R1219L	possibly damaging	Het
Ttn	C	T	2: 76,763,448	G18870D	probably damaging	Het
Tubgcp6	T	C	15: 89,100,608	Y1732C	probably damaging	Het
Vmn1r28	A	G	6: 58,265,927	T252A	probably benign	Het
Xirp2	A	G	2: 67,516,356	I2980M	probably damaging	Het
Zc2hc1c	A	G	12: 85,290,514	D315G	probably benign	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTGAACCTGAGTAGAACCTATTG -3'
(R):5'- GTACAGAAGACATATGTAAGCACTG -3'

Sequencing Primer
(F):5'- AGAACCTATTGTTTCTATGTTCCCAG -3'
(R):5'- ACATGTGTGCCTGGTACCCAC -3'

Posted On

2014-07-14